Incidental Mutation 'R4958:Myh2'
ID381716
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67192959 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1521 (E1521G)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018641
AA Change: E1521G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: E1521G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145346
Predicted Effect possibly damaging
Transcript: ENSMUST00000170159
AA Change: E1521G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: E1521G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAATGCCTACGAGGAGTCTCTG -3'
(R):5'- GCCATGTTGCTACACACAGATG -3'

Sequencing Primer
(F):5'- GTCTCTGGATCAGCTAGAAACCCTG -3'
(R):5'- CAGATGACTGTGTGCTGTGCC -3'
Posted On2016-04-27