Incidental Mutation 'R4958:Arel1'
ID381720
Institutional Source Beutler Lab
Gene Symbol Arel1
Ensembl Gene ENSMUSG00000042350
Gene Nameapoptosis resistant E3 ubiquitin protein ligase 1
Synonyms1110018G07Rik
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84918148-84970900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84926304 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 573 (K573R)
Ref Sequence ENSEMBL: ENSMUSP00000048780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043169] [ENSMUST00000163231]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043169
AA Change: K573R

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048780
Gene: ENSMUSG00000042350
AA Change: K573R

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 401 474 6e-39 BLAST
HECTc 481 823 1.04e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116345
Predicted Effect probably benign
Transcript: ENSMUST00000163231
SMART Domains Protein: ENSMUSP00000129213
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 386 474 1e-51 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Arel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Arel1 APN 12 84934162 missense probably damaging 0.98
IGL01532:Arel1 APN 12 84934162 missense possibly damaging 0.46
IGL01640:Arel1 APN 12 84920701 missense probably damaging 1.00
IGL02522:Arel1 APN 12 84927910 missense probably damaging 1.00
IGL02675:Arel1 APN 12 84930228 missense probably damaging 1.00
IGL02867:Arel1 APN 12 84934323 missense probably benign 0.01
IGL03231:Arel1 APN 12 84934310 missense probably benign
R0244:Arel1 UTSW 12 84920693 missense probably damaging 0.99
R0363:Arel1 UTSW 12 84934253 missense probably damaging 1.00
R0538:Arel1 UTSW 12 84941837 missense probably damaging 1.00
R1633:Arel1 UTSW 12 84926283 missense probably damaging 1.00
R1965:Arel1 UTSW 12 84940399 critical splice acceptor site probably null
R2161:Arel1 UTSW 12 84921256 critical splice donor site probably null
R4691:Arel1 UTSW 12 84930249 splice site probably null
R4999:Arel1 UTSW 12 84931767 missense probably damaging 0.99
R5088:Arel1 UTSW 12 84924115 missense probably damaging 1.00
R5154:Arel1 UTSW 12 84931773 missense probably benign
R5939:Arel1 UTSW 12 84926292 missense probably damaging 0.99
R5945:Arel1 UTSW 12 84926347 missense probably benign 0.20
R6118:Arel1 UTSW 12 84941939 missense possibly damaging 0.46
R6421:Arel1 UTSW 12 84934345 missense probably damaging 1.00
R6458:Arel1 UTSW 12 84940385 missense possibly damaging 0.87
R7290:Arel1 UTSW 12 84941945 missense probably benign 0.08
R7490:Arel1 UTSW 12 84941911 missense probably damaging 0.97
R7732:Arel1 UTSW 12 84927889 missense probably benign 0.45
R7743:Arel1 UTSW 12 84940269 missense probably damaging 1.00
R8021:Arel1 UTSW 12 84934958 missense possibly damaging 0.47
R8083:Arel1 UTSW 12 84940362 missense probably benign 0.00
X0066:Arel1 UTSW 12 84934382 missense probably damaging 0.99
X0066:Arel1 UTSW 12 84943329 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGACACCCTTTGCCATGAATG -3'
(R):5'- CCTAATTGCATAGGATTTGGGAG -3'

Sequencing Primer
(F):5'- GAGGTTAAGAACACTGGCTACTCTTC -3'
(R):5'- GTCTTTCCAGAATTAGCTAGAATGG -3'
Posted On2016-04-27