Mutagenetix > Incidental Mutation

Incidental Mutation 'R4958:Serac1'

381728

Institutional Source

Beutler Lab

Gene Symbol

Serac1

Ensembl Gene

ENSMUSG00000015659

Gene Name

serine active site containing 1

Synonyms

4930511N22Rik, D17Ertd141e

MMRRC Submission

042555-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4958 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6042196-6079741 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 6069382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 91 (V91D)

Ref Sequence

ENSEMBL: ENSMUSP00000095043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]

AlphaFold

Q3U213

Predicted Effect

probably benign
Transcript: ENSMUST00000024570

SMART Domains

Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
low complexity region	161	169	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
SCOP:d1jdha_	243	336	3e-5	SMART
Pfam:PGAP1	360	519	3.4e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097432
AA Change: V91D

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: V91D

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
SCOP:d1gw5a_	89	464	3e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139542

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd7	A	G	6: 18,866,723	S81G	probably benign	Het
Arel1	T	C	12: 84,926,304	K573R	possibly damaging	Het
Atf7ip	C	T	6: 136,606,810	R1280C	probably damaging	Het
Atp1a4	T	A	1: 172,231,151	D909V	probably damaging	Het
Cdh2	T	G	18: 16,627,565		probably null	Het
Col6a1	A	T	10: 76,723,505	I99N	probably damaging	Het
Dennd4c	A	G	4: 86,781,679	T256A	probably damaging	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ereg	T	C	5: 91,090,111	V152A	probably damaging	Het
Gm4950	T	C	18: 51,865,569	T105A	probably benign	Het
Hsf2	T	C	10: 57,501,371	I121T	probably damaging	Het
Kmt2a	A	T	9: 44,848,467	L728Q	probably damaging	Het
Llgl1	G	T	11: 60,711,435	R768L	probably benign	Het
Lyst	A	G	13: 13,635,463	I573V	probably benign	Het
Macf1	G	T	4: 123,475,364	T303K	probably damaging	Het
Map3k5	A	T	10: 20,023,789	Q264L	possibly damaging	Het
Mboat1	T	C	13: 30,224,393	S180P	probably damaging	Het
Mfsd6	T	C	1: 52,661,024	D655G	probably damaging	Het
Myh2	A	G	11: 67,192,959	E1521G	possibly damaging	Het
Nsd2	T	A	5: 33,892,022	S1200R	probably damaging	Het
Olfr1099	T	C	2: 86,959,105	M118V	possibly damaging	Het
Olfr1336	G	A	7: 6,461,058	C183Y	probably damaging	Het
Olfr633	T	C	7: 103,946,601	F12L	probably damaging	Het
Olfr667	T	C	7: 104,916,461	I278M	probably damaging	Het
Pbrm1	T	C	14: 31,074,827	I875T	probably damaging	Het
Pla2g1b	T	A	5: 115,470,826	F26I	probably damaging	Het
Plscr4	A	G	9: 92,484,761	N143D	possibly damaging	Het
Rab11fip1	G	T	8: 27,154,813	R315S	probably damaging	Het
Rptor	G	A	11: 119,857,391	R727Q	probably benign	Het
Slco1a6	C	A	6: 142,145,705	G90C	probably damaging	Het
Sulf1	A	G	1: 12,796,910	Y106C	probably benign	Het
Syt13	G	A	2: 92,953,449	V355M	probably damaging	Het
Tjp1	G	A	7: 65,336,102	R314*	probably null	Het
Tshr	A	G	12: 91,538,187	D633G	probably damaging	Het
Usp5	C	G	6: 124,822,630	K318N	possibly damaging	Het
Znrf4	A	G	17: 56,511,701	F202S	probably damaging	Het
Zswim8	T	A	14: 20,713,465	W427R	probably damaging	Het

Other mutations in Serac1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Serac1	APN	17	6074253	splice site	probably benign
IGL02642:Serac1	APN	17	6045746	missense	possibly damaging	0.56
IGL02972:Serac1	APN	17	6070764	nonsense	probably null
FR4304:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4340:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4342:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4589:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
PIT4480001:Serac1	UTSW	17	6050812	missense	probably damaging	1.00
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0127:Serac1	UTSW	17	6048840	missense	probably damaging	1.00
R0211:Serac1	UTSW	17	6050060	missense	possibly damaging	0.67
R0245:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R0538:Serac1	UTSW	17	6048826	splice site	probably benign
R0652:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R0988:Serac1	UTSW	17	6061580	missense	probably benign	0.02
R1965:Serac1	UTSW	17	6048999	missense	possibly damaging	0.72
R1984:Serac1	UTSW	17	6045689	splice site	probably null
R2145:Serac1	UTSW	17	6050785	missense	probably damaging	1.00
R3426:Serac1	UTSW	17	6066778	missense	probably benign	0.04
R3921:Serac1	UTSW	17	6066792	missense	probably damaging	1.00
R4760:Serac1	UTSW	17	6051790	missense	possibly damaging	0.69
R5552:Serac1	UTSW	17	6056692	nonsense	probably null
R5874:Serac1	UTSW	17	6043913	unclassified	probably benign
R5964:Serac1	UTSW	17	6065049	missense	probably benign
R6614:Serac1	UTSW	17	6045662	missense	probably damaging	1.00
R6794:Serac1	UTSW	17	6051710	missense	probably damaging	1.00
R6949:Serac1	UTSW	17	6051815	missense	probably damaging	1.00
R7157:Serac1	UTSW	17	6074201	missense	probably benign
R7161:Serac1	UTSW	17	6065076	missense	probably damaging	0.97
R7426:Serac1	UTSW	17	6069314	missense	probably damaging	1.00
R8270:Serac1	UTSW	17	6050758	missense	probably damaging	1.00
R8733:Serac1	UTSW	17	6050028	missense	probably damaging	1.00
R8785:Serac1	UTSW	17	6044202	missense	probably damaging	0.99
R9057:Serac1	UTSW	17	6061615	missense	probably damaging	0.98
R9657:Serac1	UTSW	17	6069383	missense	probably benign	0.04
Z1088:Serac1	UTSW	17	6048918	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGTTCTTCTGCCAGCTTC -3'
(R):5'- AAATGTGTTGCCACTTACAGC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CACTTACAGCGGCAATAAGAGGTC -3'

Posted On

2016-04-27