Incidental Mutation 'R4958:Gm4950'
ID381732
Institutional Source Beutler Lab
Gene Symbol Gm4950
Ensembl Gene ENSMUSG00000069379
Gene Namepredicted pseudogene 4950
Synonyms
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location51865264-51865881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51865569 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 105 (T105A)
Ref Sequence ENSEMBL: ENSMUSP00000089519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091905]
Predicted Effect probably benign
Transcript: ENSMUST00000091905
AA Change: T105A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089519
Gene: ENSMUSG00000069379
AA Change: T105A

DomainStartEndE-ValueType
Pfam:Proteasome 6 190 1.6e-41 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Zswim8 T A 14: 20,713,465 W427R probably damaging Het
Other mutations in Gm4950
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Gm4950 APN 18 51865334 missense probably damaging 0.99
IGL02904:Gm4950 APN 18 51865731 missense probably benign
R1203:Gm4950 UTSW 18 51865758 missense probably benign
R2422:Gm4950 UTSW 18 51865784 missense probably benign 0.41
R4597:Gm4950 UTSW 18 51865793 missense probably benign 0.06
R7074:Gm4950 UTSW 18 51865449 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAATGGTTTCAAACAGGTGTTCTG -3'
(R):5'- TGACCACGGACTTCCAGAAG -3'

Sequencing Primer
(F):5'- CTGGATCCATGTGGGGCTC -3'
(R):5'- GGACTTCCAGAAGATCTTTGCCATG -3'
Posted On2016-04-27