Incidental Mutation 'R4961:Ankrd44'
ID381736
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission 042558-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4961 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54663912 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 482 (D482N)
Ref Sequence ENSEMBL: ENSMUSP00000136802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000178226] [ENSMUST00000179030]
Predicted Effect probably damaging
Transcript: ENSMUST00000044359
AA Change: D685N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: D685N

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177704
Predicted Effect probably damaging
Transcript: ENSMUST00000178226
AA Change: D482N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331
AA Change: D482N

DomainStartEndE-ValueType
ANK 2 31 1.1e-6 SMART
ANK 35 64 9.7e-8 SMART
ANK 68 98 1.11e-2 SMART
ANK 102 131 9.35e-1 SMART
ANK 135 164 2.02e-5 SMART
ANK 168 197 5.98e1 SMART
ANK 219 248 7.13e-6 SMART
ANK 252 281 1.18e-6 SMART
ANK 285 342 1.17e2 SMART
ANK 346 376 3.31e-1 SMART
ANK 381 410 3.91e-3 SMART
ANK 414 443 1.43e-5 SMART
ANK 448 477 2.73e-2 SMART
ANK 484 513 5.41e-6 SMART
ANK 517 546 5.53e-3 SMART
ANK 550 582 1.52e0 SMART
ANK 586 616 9.27e-5 SMART
ANK 618 648 1.52e0 SMART
ANK 653 682 6.02e-4 SMART
ANK 686 716 3.08e-1 SMART
ANK 720 752 3.36e-2 SMART
ANK 756 785 6.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179030
AA Change: D667N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: D667N

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179242
Meta Mutation Damage Score 0.4671 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 88.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik T C 5: 139,364,100 K65E probably damaging Het
Acp5 C A 9: 22,129,937 A65S probably benign Het
Adad2 G A 8: 119,615,658 R345H probably damaging Het
Adamts7 G T 9: 90,185,740 G428W probably damaging Het
Amy1 A G 3: 113,561,849 S326P probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano8 G C 8: 71,482,996 P326R probably damaging Het
Arhgef26 A G 3: 62,459,625 E793G probably damaging Het
Cd9 A T 6: 125,463,740 V96E probably damaging Het
Cdh9 A G 15: 16,850,828 N561S probably benign Het
Col16a1 G A 4: 130,054,479 probably null Het
Cpne7 G A 8: 123,133,759 G484R probably damaging Het
Dcun1d4 A T 5: 73,544,120 K194* probably null Het
Dock3 A G 9: 106,941,316 V1193A probably damaging Het
Dst A G 1: 33,968,823 R113G possibly damaging Het
Epha5 A T 5: 84,233,643 S450T probably damaging Het
Gm10696 A T 3: 94,175,534 C323* probably null Het
Gm5581 A T 6: 131,167,227 noncoding transcript Het
Grhl3 A G 4: 135,552,607 Y379H probably damaging Het
Herpud1 T C 8: 94,390,826 S13P probably benign Het
Jam2 C T 16: 84,809,547 Q150* probably null Het
Jph2 C G 2: 163,375,748 R336P probably damaging Het
Kansl3 T A 1: 36,348,683 probably null Het
Kctd1 G A 18: 15,062,523 P348S probably damaging Het
Klhl30 T A 1: 91,357,384 S321T possibly damaging Het
Klhl5 T C 5: 65,152,690 probably benign Het
Letm2 T C 8: 25,594,092 H41R possibly damaging Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Map1b T C 13: 99,435,653 T187A probably damaging Het
Marveld2 T C 13: 100,611,923 N216S probably benign Het
Matn1 A G 4: 130,952,923 Y437C probably damaging Het
Oas1h T C 5: 120,871,096 Y290H probably damaging Het
Ofcc1 A G 13: 40,263,559 probably null Het
Olfr1301 A T 2: 111,754,405 D52V probably damaging Het
Olfr164 C A 16: 19,285,976 G256W probably damaging Het
Olfr954 A G 9: 39,461,887 Y152C probably damaging Het
Otof C A 5: 30,383,493 probably benign Het
Pcdh15 G T 10: 74,379,417 probably null Het
Pgk2 G A 17: 40,207,521 P339S probably damaging Het
Piezo2 T C 18: 63,052,961 probably null Het
Prex2 A G 1: 11,098,481 T234A possibly damaging Het
Rasgrf1 C T 9: 89,944,869 T177M probably benign Het
Rgs1 A T 1: 144,248,571 probably null Het
Snx25 T C 8: 46,068,192 N239S probably damaging Het
Spata31d1a T A 13: 59,701,902 H804L possibly damaging Het
Spon2 A T 5: 33,214,552 Y303* probably null Het
Thrb G A 14: 18,011,076 D151N probably benign Het
Tns1 A G 1: 73,935,915 V1170A probably benign Het
Trbv19 A T 6: 41,178,772 I26F probably damaging Het
Tstd2 T C 4: 46,120,467 N311S probably damaging Het
Ttn T A 2: 76,885,402 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r185 G A 7: 26,611,291 A263V probably benign Het
Zfp316 T C 5: 143,253,414 H950R probably damaging Het
Zfp51 A G 17: 21,456,353 K29E probably benign Het
Zfp644 T C 5: 106,618,215 probably benign Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7414:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R7490:Ankrd44 UTSW 1 54648300 missense probably benign 0.03
R7501:Ankrd44 UTSW 1 54649363 missense
R7515:Ankrd44 UTSW 1 54766355 missense probably damaging 1.00
R7527:Ankrd44 UTSW 1 54648324 missense probably benign 0.08
R7807:Ankrd44 UTSW 1 54792476 missense probably damaging 1.00
R8164:Ankrd44 UTSW 1 54663979 missense probably damaging 1.00
R8247:Ankrd44 UTSW 1 54752943 missense probably damaging 1.00
R8408:Ankrd44 UTSW 1 54723098 missense probably benign 0.00
R8859:Ankrd44 UTSW 1 54667521 missense possibly damaging 0.94
RF021:Ankrd44 UTSW 1 54778312 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAAGACGCGCACACTGAG -3'
(R):5'- TAGCAGCCGTGAGAAATAACTG -3'

Sequencing Primer
(F):5'- CCCTTTAGTACAGGCTCTGGTG -3'
(R):5'- CACTGTGTTTGAGGCTAC -3'
Posted On2016-04-27