Incidental Mutation 'R4961:Map1b'
ID 381780
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission 042558-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4961 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 99421446-99516540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99435653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762] [ENSMUST00000223725]
AlphaFold P14873
Predicted Effect probably damaging
Transcript: ENSMUST00000064762
AA Change: T187A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T187A

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect probably benign
Transcript: ENSMUST00000223725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Meta Mutation Damage Score 0.2882 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 88.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik T C 5: 139,364,100 K65E probably damaging Het
Acp5 C A 9: 22,129,937 A65S probably benign Het
Adad2 G A 8: 119,615,658 R345H probably damaging Het
Adamts7 G T 9: 90,185,740 G428W probably damaging Het
Amy1 A G 3: 113,561,849 S326P probably damaging Het
Ankrd44 C T 1: 54,663,912 D482N probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano8 G C 8: 71,482,996 P326R probably damaging Het
Arhgef26 A G 3: 62,459,625 E793G probably damaging Het
Cd9 A T 6: 125,463,740 V96E probably damaging Het
Cdh9 A G 15: 16,850,828 N561S probably benign Het
Col16a1 G A 4: 130,054,479 probably null Het
Cpne7 G A 8: 123,133,759 G484R probably damaging Het
Dcun1d4 A T 5: 73,544,120 K194* probably null Het
Dock3 A G 9: 106,941,316 V1193A probably damaging Het
Dst A G 1: 33,968,823 R113G possibly damaging Het
Epha5 A T 5: 84,233,643 S450T probably damaging Het
Gm10696 A T 3: 94,175,534 C323* probably null Het
Gm5581 A T 6: 131,167,227 noncoding transcript Het
Grhl3 A G 4: 135,552,607 Y379H probably damaging Het
Herpud1 T C 8: 94,390,826 S13P probably benign Het
Jam2 C T 16: 84,809,547 Q150* probably null Het
Jph2 C G 2: 163,375,748 R336P probably damaging Het
Kansl3 T A 1: 36,348,683 probably null Het
Kctd1 G A 18: 15,062,523 P348S probably damaging Het
Klhl30 T A 1: 91,357,384 S321T possibly damaging Het
Klhl5 T C 5: 65,152,690 probably benign Het
Letm2 T C 8: 25,594,092 H41R possibly damaging Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Marveld2 T C 13: 100,611,923 N216S probably benign Het
Matn1 A G 4: 130,952,923 Y437C probably damaging Het
Oas1h T C 5: 120,871,096 Y290H probably damaging Het
Ofcc1 A G 13: 40,263,559 probably null Het
Olfr1301 A T 2: 111,754,405 D52V probably damaging Het
Olfr164 C A 16: 19,285,976 G256W probably damaging Het
Olfr954 A G 9: 39,461,887 Y152C probably damaging Het
Otof C A 5: 30,383,493 probably benign Het
Pcdh15 G T 10: 74,379,417 probably null Het
Pgk2 G A 17: 40,207,521 P339S probably damaging Het
Piezo2 T C 18: 63,052,961 probably null Het
Prex2 A G 1: 11,098,481 T234A possibly damaging Het
Rasgrf1 C T 9: 89,944,869 T177M probably benign Het
Rgs1 A T 1: 144,248,571 probably null Het
Snx25 T C 8: 46,068,192 N239S probably damaging Het
Spata31d1a T A 13: 59,701,902 H804L possibly damaging Het
Spon2 A T 5: 33,214,552 Y303* probably null Het
Thrb G A 14: 18,011,076 D151N probably benign Het
Tns1 A G 1: 73,935,915 V1170A probably benign Het
Trbv19 A T 6: 41,178,772 I26F probably damaging Het
Tstd2 T C 4: 46,120,467 N311S probably damaging Het
Ttn T A 2: 76,885,402 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r185 G A 7: 26,611,291 A263V probably benign Het
Zfp316 T C 5: 143,253,414 H950R probably damaging Het
Zfp51 A G 17: 21,456,353 K29E probably benign Het
Zfp644 T C 5: 106,618,215 probably benign Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
R8470:Map1b UTSW 13 99516442 missense probably damaging 0.98
R8535:Map1b UTSW 13 99435154 missense probably damaging 1.00
R8777:Map1b UTSW 13 99430796 missense unknown
R8777-TAIL:Map1b UTSW 13 99430796 missense unknown
R8812:Map1b UTSW 13 99432815 missense unknown
R8903:Map1b UTSW 13 99432509 nonsense probably null
R8928:Map1b UTSW 13 99432116 missense unknown
R8954:Map1b UTSW 13 99434227 missense unknown
R9164:Map1b UTSW 13 99425843 missense unknown
R9164:Map1b UTSW 13 99432308 nonsense probably null
R9190:Map1b UTSW 13 99435406 missense probably damaging 0.99
R9334:Map1b UTSW 13 99431640 missense unknown
R9339:Map1b UTSW 13 99431062 missense unknown
R9357:Map1b UTSW 13 99430200 nonsense probably null
R9430:Map1b UTSW 13 99434108 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGGTTCCAGGATGTCAAAGG -3'
(R):5'- TATTTTAGTCAGGGCCATGGC -3'

Sequencing Primer
(F):5'- GGAGAGGGGACTTCTACAGACTC -3'
(R):5'- CCTAGAACTTGCTTTGTAGACCAGG -3'
Posted On 2016-04-27