Incidental Mutation 'R4961:Olfr164'
ID381784
Institutional Source Beutler Lab
Gene Symbol Olfr164
Ensembl Gene ENSMUSG00000050742
Gene Nameolfactory receptor 164
SynonymsGA_x54KRFPKG5P-15738260-15737319, MOR279-2
MMRRC Submission 042558-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4961 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19284104-19314064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19285976 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 256 (G256W)
Ref Sequence ENSEMBL: ENSMUSP00000149971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056727] [ENSMUST00000216157]
Predicted Effect probably damaging
Transcript: ENSMUST00000056727
AA Change: G256W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056970
Gene: ENSMUSG00000050742
AA Change: G256W

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.2e-8 PFAM
Pfam:7tm_1 44 293 5.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216157
AA Change: G256W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 88.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik T C 5: 139,364,100 K65E probably damaging Het
Acp5 C A 9: 22,129,937 A65S probably benign Het
Adad2 G A 8: 119,615,658 R345H probably damaging Het
Adamts7 G T 9: 90,185,740 G428W probably damaging Het
Amy1 A G 3: 113,561,849 S326P probably damaging Het
Ankrd44 C T 1: 54,663,912 D482N probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano8 G C 8: 71,482,996 P326R probably damaging Het
Arhgef26 A G 3: 62,459,625 E793G probably damaging Het
Cd9 A T 6: 125,463,740 V96E probably damaging Het
Cdh9 A G 15: 16,850,828 N561S probably benign Het
Col16a1 G A 4: 130,054,479 probably null Het
Cpne7 G A 8: 123,133,759 G484R probably damaging Het
Dcun1d4 A T 5: 73,544,120 K194* probably null Het
Dock3 A G 9: 106,941,316 V1193A probably damaging Het
Dst A G 1: 33,968,823 R113G possibly damaging Het
Epha5 A T 5: 84,233,643 S450T probably damaging Het
Gm10696 A T 3: 94,175,534 C323* probably null Het
Gm5581 A T 6: 131,167,227 noncoding transcript Het
Grhl3 A G 4: 135,552,607 Y379H probably damaging Het
Herpud1 T C 8: 94,390,826 S13P probably benign Het
Jam2 C T 16: 84,809,547 Q150* probably null Het
Jph2 C G 2: 163,375,748 R336P probably damaging Het
Kansl3 T A 1: 36,348,683 probably null Het
Kctd1 G A 18: 15,062,523 P348S probably damaging Het
Klhl30 T A 1: 91,357,384 S321T possibly damaging Het
Klhl5 T C 5: 65,152,690 probably benign Het
Letm2 T C 8: 25,594,092 H41R possibly damaging Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Map1b T C 13: 99,435,653 T187A probably damaging Het
Marveld2 T C 13: 100,611,923 N216S probably benign Het
Matn1 A G 4: 130,952,923 Y437C probably damaging Het
Oas1h T C 5: 120,871,096 Y290H probably damaging Het
Ofcc1 A G 13: 40,263,559 probably null Het
Olfr1301 A T 2: 111,754,405 D52V probably damaging Het
Olfr954 A G 9: 39,461,887 Y152C probably damaging Het
Otof C A 5: 30,383,493 probably benign Het
Pcdh15 G T 10: 74,379,417 probably null Het
Pgk2 G A 17: 40,207,521 P339S probably damaging Het
Piezo2 T C 18: 63,052,961 probably null Het
Prex2 A G 1: 11,098,481 T234A possibly damaging Het
Rasgrf1 C T 9: 89,944,869 T177M probably benign Het
Rgs1 A T 1: 144,248,571 probably null Het
Snx25 T C 8: 46,068,192 N239S probably damaging Het
Spata31d1a T A 13: 59,701,902 H804L possibly damaging Het
Spon2 A T 5: 33,214,552 Y303* probably null Het
Thrb G A 14: 18,011,076 D151N probably benign Het
Tns1 A G 1: 73,935,915 V1170A probably benign Het
Trbv19 A T 6: 41,178,772 I26F probably damaging Het
Tstd2 T C 4: 46,120,467 N311S probably damaging Het
Ttn T A 2: 76,885,402 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r185 G A 7: 26,611,291 A263V probably benign Het
Zfp316 T C 5: 143,253,414 H950R probably damaging Het
Zfp51 A G 17: 21,456,353 K29E probably benign Het
Zfp644 T C 5: 106,618,215 probably benign Het
Other mutations in Olfr164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Olfr164 APN 16 19286700 missense probably benign 0.01
IGL01569:Olfr164 APN 16 19286660 missense probably benign 0.28
IGL01619:Olfr164 APN 16 19286159 missense probably damaging 1.00
IGL02101:Olfr164 APN 16 19286613 missense probably benign
IGL02201:Olfr164 APN 16 19286462 missense probably benign 0.03
IGL02730:Olfr164 APN 16 19286682 missense probably benign 0.00
IGL03228:Olfr164 APN 16 19286390 missense probably damaging 1.00
R1566:Olfr164 UTSW 16 19286327 missense possibly damaging 0.76
R1817:Olfr164 UTSW 16 19285877 missense probably damaging 1.00
R1870:Olfr164 UTSW 16 19286607 missense probably damaging 1.00
R1918:Olfr164 UTSW 16 19286302 missense probably benign 0.03
R2202:Olfr164 UTSW 16 19286297 missense probably benign 0.03
R2265:Olfr164 UTSW 16 19286555 missense probably damaging 1.00
R3792:Olfr164 UTSW 16 19285946 missense possibly damaging 0.54
R4285:Olfr164 UTSW 16 19285964 missense probably damaging 1.00
R5022:Olfr164 UTSW 16 19286059 missense probably damaging 1.00
R5432:Olfr164 UTSW 16 19286089 missense probably benign 0.06
R5827:Olfr164 UTSW 16 19286432 missense probably benign 0.24
R6154:Olfr164 UTSW 16 19286431 missense probably damaging 0.99
R6188:Olfr164 UTSW 16 19286557 missense probably damaging 1.00
R6367:Olfr164 UTSW 16 19286072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAACTCATGCTGCTGC -3'
(R):5'- TGTGGTGCCAGAGAAATACC -3'

Sequencing Primer
(F):5'- AACTCATGCTGCTGCCTTATCAATC -3'
(R):5'- GCCTTACTCACACTTTCATGTAG -3'
Posted On2016-04-27