Incidental Mutation 'R4961:Zfp51'
ID381787
Institutional Source Beutler Lab
Gene Symbol Zfp51
Ensembl Gene ENSMUSG00000023892
Gene Namezinc finger protein 51
SynonymsZfp-51, zfec12
MMRRC Submission 042558-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R4961 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21450374-21465587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21456353 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 29 (K29E)
Ref Sequence ENSEMBL: ENSMUSP00000045684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039577]
Predicted Effect probably benign
Transcript: ENSMUST00000039577
AA Change: K29E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045684
Gene: ENSMUSG00000023892
AA Change: K29E

DomainStartEndE-ValueType
KRAB 43 103 1.71e-22 SMART
ZnF_C2H2 214 236 2.36e-2 SMART
ZnF_C2H2 242 264 8.94e-3 SMART
ZnF_C2H2 270 292 7.9e-4 SMART
ZnF_C2H2 298 320 3.44e-4 SMART
ZnF_C2H2 326 348 7.15e-2 SMART
ZnF_C2H2 354 376 4.54e-4 SMART
ZnF_C2H2 382 404 3.44e-4 SMART
ZnF_C2H2 410 432 9.88e-5 SMART
ZnF_C2H2 438 460 3.16e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
ZnF_C2H2 494 517 2.57e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 1.4e-4 SMART
ZnF_C2H2 579 601 4.17e-3 SMART
ZnF_C2H2 607 629 2.79e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 9.08e-4 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
ZnF_C2H2 719 741 1.36e-2 SMART
ZnF_C2H2 747 769 6.82e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 88.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik T C 5: 139,364,100 K65E probably damaging Het
Acp5 C A 9: 22,129,937 A65S probably benign Het
Adad2 G A 8: 119,615,658 R345H probably damaging Het
Adamts7 G T 9: 90,185,740 G428W probably damaging Het
Amy1 A G 3: 113,561,849 S326P probably damaging Het
Ankrd44 C T 1: 54,663,912 D482N probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano8 G C 8: 71,482,996 P326R probably damaging Het
Arhgef26 A G 3: 62,459,625 E793G probably damaging Het
Cd9 A T 6: 125,463,740 V96E probably damaging Het
Cdh9 A G 15: 16,850,828 N561S probably benign Het
Col16a1 G A 4: 130,054,479 probably null Het
Cpne7 G A 8: 123,133,759 G484R probably damaging Het
Dcun1d4 A T 5: 73,544,120 K194* probably null Het
Dock3 A G 9: 106,941,316 V1193A probably damaging Het
Dst A G 1: 33,968,823 R113G possibly damaging Het
Epha5 A T 5: 84,233,643 S450T probably damaging Het
Gm10696 A T 3: 94,175,534 C323* probably null Het
Gm5581 A T 6: 131,167,227 noncoding transcript Het
Grhl3 A G 4: 135,552,607 Y379H probably damaging Het
Herpud1 T C 8: 94,390,826 S13P probably benign Het
Jam2 C T 16: 84,809,547 Q150* probably null Het
Jph2 C G 2: 163,375,748 R336P probably damaging Het
Kansl3 T A 1: 36,348,683 probably null Het
Kctd1 G A 18: 15,062,523 P348S probably damaging Het
Klhl30 T A 1: 91,357,384 S321T possibly damaging Het
Klhl5 T C 5: 65,152,690 probably benign Het
Letm2 T C 8: 25,594,092 H41R possibly damaging Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Map1b T C 13: 99,435,653 T187A probably damaging Het
Marveld2 T C 13: 100,611,923 N216S probably benign Het
Matn1 A G 4: 130,952,923 Y437C probably damaging Het
Oas1h T C 5: 120,871,096 Y290H probably damaging Het
Ofcc1 A G 13: 40,263,559 probably null Het
Olfr1301 A T 2: 111,754,405 D52V probably damaging Het
Olfr164 C A 16: 19,285,976 G256W probably damaging Het
Olfr954 A G 9: 39,461,887 Y152C probably damaging Het
Otof C A 5: 30,383,493 probably benign Het
Pcdh15 G T 10: 74,379,417 probably null Het
Pgk2 G A 17: 40,207,521 P339S probably damaging Het
Piezo2 T C 18: 63,052,961 probably null Het
Prex2 A G 1: 11,098,481 T234A possibly damaging Het
Rasgrf1 C T 9: 89,944,869 T177M probably benign Het
Rgs1 A T 1: 144,248,571 probably null Het
Snx25 T C 8: 46,068,192 N239S probably damaging Het
Spata31d1a T A 13: 59,701,902 H804L possibly damaging Het
Spon2 A T 5: 33,214,552 Y303* probably null Het
Thrb G A 14: 18,011,076 D151N probably benign Het
Tns1 A G 1: 73,935,915 V1170A probably benign Het
Trbv19 A T 6: 41,178,772 I26F probably damaging Het
Tstd2 T C 4: 46,120,467 N311S probably damaging Het
Ttn T A 2: 76,885,402 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r185 G A 7: 26,611,291 A263V probably benign Het
Zfp316 T C 5: 143,253,414 H950R probably damaging Het
Zfp644 T C 5: 106,618,215 probably benign Het
Other mutations in Zfp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp51 APN 17 21463452 missense probably benign 0.11
IGL00971:Zfp51 APN 17 21463582 missense probably benign 0.03
IGL02002:Zfp51 APN 17 21463959 missense probably damaging 0.98
IGL02268:Zfp51 APN 17 21463419 nonsense probably null
IGL03249:Zfp51 APN 17 21463439 missense probably damaging 1.00
R1569:Zfp51 UTSW 17 21456380 missense probably benign 0.01
R1853:Zfp51 UTSW 17 21464323 missense probably damaging 1.00
R1989:Zfp51 UTSW 17 21456320 missense possibly damaging 0.90
R2285:Zfp51 UTSW 17 21463875 missense probably damaging 1.00
R2407:Zfp51 UTSW 17 21463831 missense probably damaging 0.98
R2890:Zfp51 UTSW 17 21463856 missense probably damaging 1.00
R3918:Zfp51 UTSW 17 21463440 missense probably benign
R4529:Zfp51 UTSW 17 21464736 missense probably damaging 1.00
R4587:Zfp51 UTSW 17 21464916 nonsense probably null
R4866:Zfp51 UTSW 17 21461750 missense possibly damaging 0.61
R4872:Zfp51 UTSW 17 21464671 missense probably benign 0.26
R5392:Zfp51 UTSW 17 21465322 missense possibly damaging 0.60
R5611:Zfp51 UTSW 17 21464092 missense probably damaging 1.00
R7109:Zfp51 UTSW 17 21463569 missense possibly damaging 0.80
R7129:Zfp51 UTSW 17 21461709 missense probably damaging 1.00
R7269:Zfp51 UTSW 17 21463698 missense probably benign 0.09
R7303:Zfp51 UTSW 17 21463796 missense probably benign 0.24
R7514:Zfp51 UTSW 17 21463500 missense probably benign 0.37
R7665:Zfp51 UTSW 17 21463581 missense probably benign 0.00
R8073:Zfp51 UTSW 17 21464032 missense probably damaging 1.00
R8177:Zfp51 UTSW 17 21463867 missense probably benign 0.05
X0062:Zfp51 UTSW 17 21464995 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCAGCACCATGGTTGATG -3'
(R):5'- AGTTCTCAATGACTAATGTAACCAC -3'

Sequencing Primer
(F):5'- CAGCACCATGGTTGATGTTGATTTC -3'
(R):5'- ATCAGTCTGGTTAATTTCAGAGTTTG -3'
Posted On2016-04-27