Incidental Mutation 'R4961:Kctd1'
ID 381789
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Name potassium channel tetramerisation domain containing 1
Synonyms 4933402K10Rik
MMRRC Submission 042558-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4961 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 15101742-15284503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15195580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 348 (P348S)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025992
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168989
AA Change: P348S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: P348S

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Meta Mutation Damage Score 0.1213 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 88.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik T C 5: 139,349,855 (GRCm39) K65E probably damaging Het
Acp5 C A 9: 22,041,233 (GRCm39) A65S probably benign Het
Adad2 G A 8: 120,342,397 (GRCm39) R345H probably damaging Het
Adamts7 G T 9: 90,067,793 (GRCm39) G428W probably damaging Het
Amy1 A G 3: 113,355,498 (GRCm39) S326P probably damaging Het
Ankrd44 C T 1: 54,703,071 (GRCm39) D482N probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano8 G C 8: 71,935,640 (GRCm39) P326R probably damaging Het
Arhgef26 A G 3: 62,367,046 (GRCm39) E793G probably damaging Het
Cd9 A T 6: 125,440,703 (GRCm39) V96E probably damaging Het
Cdh9 A G 15: 16,850,914 (GRCm39) N561S probably benign Het
Col16a1 G A 4: 129,948,272 (GRCm39) probably null Het
Cpne7 G A 8: 123,860,498 (GRCm39) G484R probably damaging Het
Dcun1d4 A T 5: 73,701,463 (GRCm39) K194* probably null Het
Dock3 A G 9: 106,818,515 (GRCm39) V1193A probably damaging Het
Dst A G 1: 34,007,904 (GRCm39) R113G possibly damaging Het
Epha5 A T 5: 84,381,502 (GRCm39) S450T probably damaging Het
Gm5581 A T 6: 131,144,190 (GRCm39) noncoding transcript Het
Grhl3 A G 4: 135,279,918 (GRCm39) Y379H probably damaging Het
Herpud1 T C 8: 95,117,454 (GRCm39) S13P probably benign Het
Jam2 C T 16: 84,606,435 (GRCm39) Q150* probably null Het
Jph2 C G 2: 163,217,668 (GRCm39) R336P probably damaging Het
Kansl3 T A 1: 36,387,764 (GRCm39) probably null Het
Klhl30 T A 1: 91,285,106 (GRCm39) S321T possibly damaging Het
Klhl5 T C 5: 65,310,033 (GRCm39) probably benign Het
Letm2 T C 8: 26,084,108 (GRCm39) H41R possibly damaging Het
Ltn1 A T 16: 87,194,679 (GRCm39) C1407S probably benign Het
Map1b T C 13: 99,572,161 (GRCm39) T187A probably damaging Het
Marveld2 T C 13: 100,748,431 (GRCm39) N216S probably benign Het
Matn1 A G 4: 130,680,234 (GRCm39) Y437C probably damaging Het
Oas1h T C 5: 121,009,159 (GRCm39) Y290H probably damaging Het
Ofcc1 A G 13: 40,417,035 (GRCm39) probably null Het
Or2m12 C A 16: 19,104,726 (GRCm39) G256W probably damaging Het
Or4k51 A T 2: 111,584,750 (GRCm39) D52V probably damaging Het
Or8g34 A G 9: 39,373,183 (GRCm39) Y152C probably damaging Het
Otof C A 5: 30,540,837 (GRCm39) probably benign Het
Pcdh15 G T 10: 74,215,249 (GRCm39) probably null Het
Pgk2 G A 17: 40,518,412 (GRCm39) P339S probably damaging Het
Piezo2 T C 18: 63,186,032 (GRCm39) probably null Het
Prex2 A G 1: 11,168,705 (GRCm39) T234A possibly damaging Het
Rasgrf1 C T 9: 89,826,922 (GRCm39) T177M probably benign Het
Rgs1 A T 1: 144,124,309 (GRCm39) probably null Het
Snx25 T C 8: 46,521,229 (GRCm39) N239S probably damaging Het
Spata31d1a T A 13: 59,849,716 (GRCm39) H804L possibly damaging Het
Spon2 A T 5: 33,371,896 (GRCm39) Y303* probably null Het
Spopfm2 A T 3: 94,082,841 (GRCm39) C323* probably null Het
Thrb G A 14: 18,011,076 (GRCm38) D151N probably benign Het
Tns1 A G 1: 73,975,074 (GRCm39) V1170A probably benign Het
Trbv19 A T 6: 41,155,706 (GRCm39) I26F probably damaging Het
Tstd2 T C 4: 46,120,467 (GRCm39) N311S probably damaging Het
Ttn T A 2: 76,715,746 (GRCm39) probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Vmn1r185 G A 7: 26,310,716 (GRCm39) A263V probably benign Het
Zfp316 T C 5: 143,239,169 (GRCm39) H950R probably damaging Het
Zfp51 A G 17: 21,676,615 (GRCm39) K29E probably benign Het
Zfp644 T C 5: 106,766,081 (GRCm39) probably benign Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15,195,747 (GRCm39) missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01404:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15,195,694 (GRCm39) missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15,195,937 (GRCm39) missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 15,102,667 (GRCm39) missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 15,107,036 (GRCm39) critical splice donor site probably null
R0128:Kctd1 UTSW 18 15,107,237 (GRCm39) missense probably benign 0.00
R0598:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15,195,654 (GRCm39) missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15,195,517 (GRCm39) missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 15,102,617 (GRCm39) missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15,196,263 (GRCm39) intron probably benign
R1779:Kctd1 UTSW 18 15,194,839 (GRCm39) missense probably benign 0.01
R2083:Kctd1 UTSW 18 15,107,112 (GRCm39) missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15,195,268 (GRCm39) missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 15,107,143 (GRCm39) missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15,140,757 (GRCm39) missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15,196,284 (GRCm39) intron probably benign
R4884:Kctd1 UTSW 18 15,107,311 (GRCm39) missense probably damaging 1.00
R5169:Kctd1 UTSW 18 15,195,822 (GRCm39) missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15,195,322 (GRCm39) missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15,196,573 (GRCm39) intron probably benign
R5893:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 15,102,688 (GRCm39) nonsense probably null
R6767:Kctd1 UTSW 18 15,195,232 (GRCm39) missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 15,119,401 (GRCm39) missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 15,107,045 (GRCm39) missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15,195,700 (GRCm39) missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15,195,469 (GRCm39) missense possibly damaging 0.95
R7688:Kctd1 UTSW 18 15,107,255 (GRCm39) missense probably benign 0.03
R8085:Kctd1 UTSW 18 15,140,901 (GRCm39) missense possibly damaging 0.95
R8195:Kctd1 UTSW 18 15,196,300 (GRCm39) missense unknown
R8496:Kctd1 UTSW 18 15,107,228 (GRCm39) missense probably damaging 1.00
R8924:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R8978:Kctd1 UTSW 18 15,119,491 (GRCm39) missense
R9094:Kctd1 UTSW 18 15,195,369 (GRCm39) missense possibly damaging 0.71
R9255:Kctd1 UTSW 18 15,194,853 (GRCm39) missense probably benign 0.00
R9629:Kctd1 UTSW 18 15,196,611 (GRCm39) missense unknown
R9680:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
Z1176:Kctd1 UTSW 18 15,196,182 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTGGACAGCATCTGCATC -3'
(R):5'- TACACCTCCAGCGTCTTCAG -3'

Sequencing Primer
(F):5'- ACAGCATCTGCATCCTGGTG -3'
(R):5'- GCACCAACACGCCCTTTGG -3'
Posted On 2016-04-27