Mutagenetix > Incidental Mutation

Incidental Mutation 'R4961:Piezo2'

381790

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

042558-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 63052961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000047480

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.3%
20x: 88.3%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	T	C	5: 139,364,100	K65E	probably damaging	Het
Acp5	C	A	9: 22,129,937	A65S	probably benign	Het
Adad2	G	A	8: 119,615,658	R345H	probably damaging	Het
Adamts7	G	T	9: 90,185,740	G428W	probably damaging	Het
Amy1	A	G	3: 113,561,849	S326P	probably damaging	Het
Ankrd44	C	T	1: 54,663,912	D482N	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano8	G	C	8: 71,482,996	P326R	probably damaging	Het
Arhgef26	A	G	3: 62,459,625	E793G	probably damaging	Het
Cd9	A	T	6: 125,463,740	V96E	probably damaging	Het
Cdh9	A	G	15: 16,850,828	N561S	probably benign	Het
Col16a1	G	A	4: 130,054,479		probably null	Het
Cpne7	G	A	8: 123,133,759	G484R	probably damaging	Het
Dcun1d4	A	T	5: 73,544,120	K194*	probably null	Het
Dock3	A	G	9: 106,941,316	V1193A	probably damaging	Het
Dst	A	G	1: 33,968,823	R113G	possibly damaging	Het
Epha5	A	T	5: 84,233,643	S450T	probably damaging	Het
Gm10696	A	T	3: 94,175,534	C323*	probably null	Het
Gm5581	A	T	6: 131,167,227		noncoding transcript	Het
Grhl3	A	G	4: 135,552,607	Y379H	probably damaging	Het
Herpud1	T	C	8: 94,390,826	S13P	probably benign	Het
Jam2	C	T	16: 84,809,547	Q150*	probably null	Het
Jph2	C	G	2: 163,375,748	R336P	probably damaging	Het
Kansl3	T	A	1: 36,348,683		probably null	Het
Kctd1	G	A	18: 15,062,523	P348S	probably damaging	Het
Klhl30	T	A	1: 91,357,384	S321T	possibly damaging	Het
Klhl5	T	C	5: 65,152,690		probably benign	Het
Letm2	T	C	8: 25,594,092	H41R	possibly damaging	Het
Ltn1	A	T	16: 87,397,791	C1407S	probably benign	Het
Map1b	T	C	13: 99,435,653	T187A	probably damaging	Het
Marveld2	T	C	13: 100,611,923	N216S	probably benign	Het
Matn1	A	G	4: 130,952,923	Y437C	probably damaging	Het
Oas1h	T	C	5: 120,871,096	Y290H	probably damaging	Het
Ofcc1	A	G	13: 40,263,559		probably null	Het
Olfr1301	A	T	2: 111,754,405	D52V	probably damaging	Het
Olfr164	C	A	16: 19,285,976	G256W	probably damaging	Het
Olfr954	A	G	9: 39,461,887	Y152C	probably damaging	Het
Otof	C	A	5: 30,383,493		probably benign	Het
Pcdh15	G	T	10: 74,379,417		probably null	Het
Pgk2	G	A	17: 40,207,521	P339S	probably damaging	Het
Prex2	A	G	1: 11,098,481	T234A	possibly damaging	Het
Rasgrf1	C	T	9: 89,944,869	T177M	probably benign	Het
Rgs1	A	T	1: 144,248,571		probably null	Het
Snx25	T	C	8: 46,068,192	N239S	probably damaging	Het
Spata31d1a	T	A	13: 59,701,902	H804L	possibly damaging	Het
Spon2	A	T	5: 33,214,552	Y303*	probably null	Het
Thrb	G	A	14: 18,011,076	D151N	probably benign	Het
Tns1	A	G	1: 73,935,915	V1170A	probably benign	Het
Trbv19	A	T	6: 41,178,772	I26F	probably damaging	Het
Tstd2	T	C	4: 46,120,467	N311S	probably damaging	Het
Ttn	T	A	2: 76,885,402		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn1r185	G	A	7: 26,611,291	A263V	probably benign	Het
Zfp316	T	C	5: 143,253,414	H950R	probably damaging	Het
Zfp51	A	G	17: 21,456,353	K29E	probably benign	Het
Zfp644	T	C	5: 106,618,215		probably benign	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1868:Piezo2	UTSW	18	63019344	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63386276	start gained	probably benign
R9608:Piezo2	UTSW	18	63146945	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63115037	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63064696	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTTAAAATGCAAGCACACACGG -3'
(R):5'- ACTGTGCCATGCTTCTTCGG -3'

Sequencing Primer
(F):5'- TGCAAGCACACACGGAATAGTC -3'
(R):5'- TCGGCCTAGATAATATCATCAAGAGG -3'

Posted On

2016-04-27