Incidental Mutation 'R4961:Piezo2'
ID 381790
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik
MMRRC Submission 042558-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4961 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 63143284-63520254 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 63186032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000047480
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 88.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik T C 5: 139,349,855 (GRCm39) K65E probably damaging Het
Acp5 C A 9: 22,041,233 (GRCm39) A65S probably benign Het
Adad2 G A 8: 120,342,397 (GRCm39) R345H probably damaging Het
Adamts7 G T 9: 90,067,793 (GRCm39) G428W probably damaging Het
Amy1 A G 3: 113,355,498 (GRCm39) S326P probably damaging Het
Ankrd44 C T 1: 54,703,071 (GRCm39) D482N probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano8 G C 8: 71,935,640 (GRCm39) P326R probably damaging Het
Arhgef26 A G 3: 62,367,046 (GRCm39) E793G probably damaging Het
Cd9 A T 6: 125,440,703 (GRCm39) V96E probably damaging Het
Cdh9 A G 15: 16,850,914 (GRCm39) N561S probably benign Het
Col16a1 G A 4: 129,948,272 (GRCm39) probably null Het
Cpne7 G A 8: 123,860,498 (GRCm39) G484R probably damaging Het
Dcun1d4 A T 5: 73,701,463 (GRCm39) K194* probably null Het
Dock3 A G 9: 106,818,515 (GRCm39) V1193A probably damaging Het
Dst A G 1: 34,007,904 (GRCm39) R113G possibly damaging Het
Epha5 A T 5: 84,381,502 (GRCm39) S450T probably damaging Het
Gm5581 A T 6: 131,144,190 (GRCm39) noncoding transcript Het
Grhl3 A G 4: 135,279,918 (GRCm39) Y379H probably damaging Het
Herpud1 T C 8: 95,117,454 (GRCm39) S13P probably benign Het
Jam2 C T 16: 84,606,435 (GRCm39) Q150* probably null Het
Jph2 C G 2: 163,217,668 (GRCm39) R336P probably damaging Het
Kansl3 T A 1: 36,387,764 (GRCm39) probably null Het
Kctd1 G A 18: 15,195,580 (GRCm39) P348S probably damaging Het
Klhl30 T A 1: 91,285,106 (GRCm39) S321T possibly damaging Het
Klhl5 T C 5: 65,310,033 (GRCm39) probably benign Het
Letm2 T C 8: 26,084,108 (GRCm39) H41R possibly damaging Het
Ltn1 A T 16: 87,194,679 (GRCm39) C1407S probably benign Het
Map1b T C 13: 99,572,161 (GRCm39) T187A probably damaging Het
Marveld2 T C 13: 100,748,431 (GRCm39) N216S probably benign Het
Matn1 A G 4: 130,680,234 (GRCm39) Y437C probably damaging Het
Oas1h T C 5: 121,009,159 (GRCm39) Y290H probably damaging Het
Ofcc1 A G 13: 40,417,035 (GRCm39) probably null Het
Or2m12 C A 16: 19,104,726 (GRCm39) G256W probably damaging Het
Or4k51 A T 2: 111,584,750 (GRCm39) D52V probably damaging Het
Or8g34 A G 9: 39,373,183 (GRCm39) Y152C probably damaging Het
Otof C A 5: 30,540,837 (GRCm39) probably benign Het
Pcdh15 G T 10: 74,215,249 (GRCm39) probably null Het
Pgk2 G A 17: 40,518,412 (GRCm39) P339S probably damaging Het
Prex2 A G 1: 11,168,705 (GRCm39) T234A possibly damaging Het
Rasgrf1 C T 9: 89,826,922 (GRCm39) T177M probably benign Het
Rgs1 A T 1: 144,124,309 (GRCm39) probably null Het
Snx25 T C 8: 46,521,229 (GRCm39) N239S probably damaging Het
Spata31d1a T A 13: 59,849,716 (GRCm39) H804L possibly damaging Het
Spon2 A T 5: 33,371,896 (GRCm39) Y303* probably null Het
Spopfm2 A T 3: 94,082,841 (GRCm39) C323* probably null Het
Thrb G A 14: 18,011,076 (GRCm38) D151N probably benign Het
Tns1 A G 1: 73,975,074 (GRCm39) V1170A probably benign Het
Trbv19 A T 6: 41,155,706 (GRCm39) I26F probably damaging Het
Tstd2 T C 4: 46,120,467 (GRCm39) N311S probably damaging Het
Ttn T A 2: 76,715,746 (GRCm39) probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Vmn1r185 G A 7: 26,310,716 (GRCm39) A263V probably benign Het
Zfp316 T C 5: 143,239,169 (GRCm39) H950R probably damaging Het
Zfp51 A G 17: 21,676,615 (GRCm39) K29E probably benign Het
Zfp644 T C 5: 106,766,081 (GRCm39) probably benign Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,250,770 (GRCm39) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,155,531 (GRCm39) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,203,101 (GRCm39) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,257,685 (GRCm39) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,163,463 (GRCm39) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,315,904 (GRCm39) splice site probably benign
IGL01674:Piezo2 APN 18 63,160,630 (GRCm39) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,216,241 (GRCm39) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,175,859 (GRCm39) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,225,915 (GRCm39) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,153,705 (GRCm39) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,279,915 (GRCm39) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,205,933 (GRCm39) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,165,995 (GRCm39) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,157,546 (GRCm39) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,207,730 (GRCm39) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,197,856 (GRCm39) splice site probably benign
IGL03011:Piezo2 APN 18 63,257,731 (GRCm39) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,203,146 (GRCm39) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,163,343 (GRCm39) splice site probably null
IGL03129:Piezo2 APN 18 63,248,043 (GRCm39) missense probably benign
IGL03143:Piezo2 APN 18 63,241,147 (GRCm39) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,144,669 (GRCm39) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,257,677 (GRCm39) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,186,133 (GRCm39) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,174,791 (GRCm39) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,144,609 (GRCm39) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,154,379 (GRCm39) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,160,775 (GRCm39) missense probably damaging 1.00
Piccolo UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
sopranino UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
woodwind UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,519,271 (GRCm39) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,157,540 (GRCm39) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,235,155 (GRCm39) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,157,562 (GRCm39) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,162,132 (GRCm39) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,235,245 (GRCm39) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,157,522 (GRCm39) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,160,615 (GRCm39) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,155,552 (GRCm39) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,155,497 (GRCm39) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,152,329 (GRCm39) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,174,794 (GRCm39) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,216,306 (GRCm39) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,148,873 (GRCm39) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,219,824 (GRCm39) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,154,325 (GRCm39) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,216,202 (GRCm39) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,277,990 (GRCm39) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,215,986 (GRCm39) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,250,743 (GRCm39) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,154,244 (GRCm39) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,239,355 (GRCm39) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,241,158 (GRCm39) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,165,911 (GRCm39) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,152,415 (GRCm39) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,247,031 (GRCm39) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,211,911 (GRCm39) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,211,852 (GRCm39) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,277,997 (GRCm39) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,192,815 (GRCm39) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,252,006 (GRCm39) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,214,805 (GRCm39) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,250,791 (GRCm39) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,247,112 (GRCm39) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,239,345 (GRCm39) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,155,596 (GRCm39) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,378,695 (GRCm39) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,186,106 (GRCm39) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,279,914 (GRCm39) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,157,506 (GRCm39) nonsense probably null
R3016:Piezo2 UTSW 18 63,175,903 (GRCm39) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,214,864 (GRCm39) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,183,675 (GRCm39) missense probably benign
R4181:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,217,911 (GRCm39) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,235,170 (GRCm39) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,247,134 (GRCm39) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,205,951 (GRCm39) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,219,699 (GRCm39) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,203,034 (GRCm39) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,278,025 (GRCm39) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,211,862 (GRCm39) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,290,333 (GRCm39) missense probably benign
R4968:Piezo2 UTSW 18 63,278,042 (GRCm39) nonsense probably null
R4973:Piezo2 UTSW 18 63,207,751 (GRCm39) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,216,184 (GRCm39) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,157,607 (GRCm39) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,207,691 (GRCm39) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,163,480 (GRCm39) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,166,000 (GRCm39) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,197,802 (GRCm39) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,217,811 (GRCm39) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,278,176 (GRCm39) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,160,935 (GRCm39) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,144,792 (GRCm39) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,278,162 (GRCm39) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,250,768 (GRCm39) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,250,767 (GRCm39) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,279,927 (GRCm39) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,160,972 (GRCm39) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,247,005 (GRCm39) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6073:Piezo2 UTSW 18 63,145,716 (GRCm39) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,290,281 (GRCm39) nonsense probably null
R6255:Piezo2 UTSW 18 63,254,341 (GRCm39) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,250,749 (GRCm39) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,239,364 (GRCm39) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,219,678 (GRCm39) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,174,734 (GRCm39) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,239,342 (GRCm39) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,154,399 (GRCm39) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,154,333 (GRCm39) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,165,960 (GRCm39) nonsense probably null
R6855:Piezo2 UTSW 18 63,223,950 (GRCm39) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,166,057 (GRCm39) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,216,032 (GRCm39) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,278,181 (GRCm39) nonsense probably null
R7162:Piezo2 UTSW 18 63,257,780 (GRCm39) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,241,101 (GRCm39) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,150,590 (GRCm39) splice site probably null
R7395:Piezo2 UTSW 18 63,160,634 (GRCm39) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,157,543 (GRCm39) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,145,794 (GRCm39) missense probably benign
R7517:Piezo2 UTSW 18 63,215,996 (GRCm39) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,186,081 (GRCm39) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,175,610 (GRCm39) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,246,947 (GRCm39) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,216,016 (GRCm39) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,216,271 (GRCm39) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,175,882 (GRCm39) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,163,537 (GRCm39) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,208,801 (GRCm39) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,145,857 (GRCm39) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,217,759 (GRCm39) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,178,611 (GRCm39) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,279,873 (GRCm39) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,225,971 (GRCm39) nonsense probably null
R8708:Piezo2 UTSW 18 63,226,086 (GRCm39) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8727:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8810:Piezo2 UTSW 18 63,248,034 (GRCm39) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,248,096 (GRCm39) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,225,902 (GRCm39) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,178,550 (GRCm39) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,250,815 (GRCm39) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,290,302 (GRCm39) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,154,372 (GRCm39) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,208,868 (GRCm39) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,157,637 (GRCm39) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,162,156 (GRCm39) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,235,236 (GRCm39) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,519,347 (GRCm39) start gained probably benign
R9608:Piezo2 UTSW 18 63,280,016 (GRCm39) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,248,108 (GRCm39) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,197,767 (GRCm39) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,160,657 (GRCm39) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,183,681 (GRCm39) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,150,648 (GRCm39) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,203,065 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTAAAATGCAAGCACACACGG -3'
(R):5'- ACTGTGCCATGCTTCTTCGG -3'

Sequencing Primer
(F):5'- TGCAAGCACACACGGAATAGTC -3'
(R):5'- TCGGCCTAGATAATATCATCAAGAGG -3'
Posted On 2016-04-27