Incidental Mutation 'R4962:Ttbk2'
ID381802
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Nametau tubulin kinase 2
SynonymsB930008N24Rik, 2610507N02Rik, TTK
MMRRC Submission 042559-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4962 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120732816-120850604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120745150 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 1115 (Q1115H)
Ref Sequence ENSEMBL: ENSMUSP00000028740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000143051]
Predicted Effect probably damaging
Transcript: ENSMUST00000028740
AA Change: Q1115H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: Q1115H

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057135
AA Change: Q1046H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: Q1046H

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085840
AA Change: Q1046H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: Q1046H

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143051
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148285
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,808 F317L possibly damaging Het
Abcc4 A G 14: 118,668,399 I85T probably benign Het
Acoxl G T 2: 128,075,890 C498F probably damaging Het
Akap13 C T 7: 75,749,430 T2752I probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ap2a2 T G 7: 141,630,148 F836C probably damaging Het
Atp2c1 A G 9: 105,442,950 V404A probably benign Het
Atp7b G T 8: 22,020,885 A415E probably damaging Het
Babam2 A T 5: 31,785,583 I71L possibly damaging Het
Bean1 A G 8: 104,216,974 T54A probably damaging Het
Cacna1b T A 2: 24,618,318 I1816F probably damaging Het
Cacna1b C T 2: 24,657,366 G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 E536G probably damaging Het
Cfap57 A G 4: 118,613,065 V206A probably benign Het
Clca2 A T 3: 145,077,879 D658E probably damaging Het
Cwc22 A T 2: 77,896,309 S809T probably benign Het
Cyp2c54 C T 19: 40,072,141 R132Q possibly damaging Het
Ddx20 A T 3: 105,680,605 D386E possibly damaging Het
Ddx50 T C 10: 62,642,853 T185A probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dennd4a T C 9: 64,906,003 S1415P probably benign Het
Dnah12 A T 14: 26,716,700 I495L probably benign Het
Dnah2 G A 11: 69,455,973 Q2596* probably null Het
Dnajb13 A G 7: 100,507,500 L123S probably benign Het
Elavl3 G A 9: 22,036,811 P19L probably benign Het
Fer1l6 T C 15: 58,571,401 S518P probably benign Het
Fgd3 T C 13: 49,266,629 S591G probably benign Het
Galnt18 C A 7: 111,472,064 R566L probably benign Het
Galnt6 A T 15: 100,696,574 Y525* probably null Het
Gm10036 A T 18: 15,833,302 Y170F probably benign Het
Hacd2 A G 16: 35,022,551 D24G unknown Het
Idh3a T C 9: 54,596,041 M128T possibly damaging Het
Ido1 C T 8: 24,584,549 M359I probably benign Het
Ikbkb T C 8: 22,681,677 T185A probably damaging Het
Insl6 C T 19: 29,321,619 G131D probably damaging Het
Irgm1 A C 11: 48,866,332 S217R possibly damaging Het
Itga11 T A 9: 62,761,568 Y702* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl2 T C 15: 98,531,843 M103V probably benign Het
Kcnq2 T C 2: 181,112,043 N258S possibly damaging Het
Kdm5d A T Y: 940,624 D1045V probably damaging Het
Lats2 A G 14: 57,699,592 L480P probably damaging Het
Lin28b T A 10: 45,420,640 K87N possibly damaging Het
Lpgat1 T A 1: 191,719,570 W103R probably damaging Het
Lpl G T 8: 68,894,693 G166C probably damaging Het
Ly75 A T 2: 60,352,125 Y569N probably damaging Het
Mcm8 A T 2: 132,838,769 E564D probably damaging Het
Me2 G T 18: 73,785,776 N411K probably damaging Het
Mn1 A G 5: 111,454,786 T1297A possibly damaging Het
Mphosph8 T A 14: 56,678,589 F447L probably benign Het
Nacad T A 11: 6,599,169 D1294V probably damaging Het
Neu3 A T 7: 99,823,408 F41I probably damaging Het
Nlrp6 G T 7: 140,923,584 L534F probably damaging Het
Nrap A G 19: 56,378,143 M338T probably damaging Het
Nuak1 T C 10: 84,375,115 K370E probably damaging Het
Olfr1151 A G 2: 87,857,288 T38A probably benign Het
Olfr1425 T A 19: 12,074,275 D119V probably damaging Het
Olfr479 T A 7: 108,055,440 C153S probably benign Het
Olfr805 C T 10: 129,722,723 V274M probably damaging Het
P3h3 T C 6: 124,841,773 S701G probably benign Het
Pdss2 T C 10: 43,298,912 M138T possibly damaging Het
Piezo1 C T 8: 122,486,481 E1848K probably benign Het
Prmt3 T G 7: 49,826,809 S389A probably benign Het
Prrxl1 G T 14: 32,647,144 probably benign Het
Prune2 T A 19: 17,122,273 F1714I probably benign Het
Ptgis A G 2: 167,225,274 probably null Het
Ptpn20 T C 14: 33,614,459 V85A probably benign Het
Rabepk A T 2: 34,780,657 Y264N probably damaging Het
Ralgapa2 A T 2: 146,434,834 C495* probably null Het
Satb2 A G 1: 56,891,168 I232T probably benign Het
Selenbp2 A T 3: 94,703,549 L307F probably damaging Het
Sgpl1 T G 10: 61,114,084 Y112S probably damaging Het
Slitrk5 T C 14: 111,681,247 S768P probably benign Het
Smc3 T A 19: 53,631,517 Y615N probably damaging Het
Spag17 A G 3: 100,027,623 N715S probably benign Het
Spats2 A G 15: 99,212,276 E518G probably benign Het
Spats2l A G 1: 57,885,824 H127R possibly damaging Het
Tenm3 T A 8: 48,278,961 K1287* probably null Het
Thoc1 T A 18: 9,962,387 S91T probably benign Het
Thoc6 C T 17: 23,669,937 G166S probably damaging Het
Tmem107 C A 11: 69,071,261 T42N possibly damaging Het
Tmprss11c A G 5: 86,237,710 I288T probably damaging Het
Tnrc18 A G 5: 142,739,493 F1827S unknown Het
Trmt112 C A 19: 6,910,198 T5N probably damaging Het
Trp53bp1 A T 2: 121,270,546 M57K probably benign Het
Ttn C A 2: 76,729,645 E27725* probably null Het
Ttn A G 2: 76,944,109 M2151T probably damaging Het
Usp9y A T Y: 1,384,336 D727E probably damaging Het
Vps13c A G 9: 67,873,891 T221A probably damaging Het
Zbtb20 A G 16: 43,618,692 D725G probably damaging Het
Zfp341 A T 2: 154,626,814 I126F possibly damaging Het
Zfyve16 C T 13: 92,513,894 A861T probably damaging Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0279:Ttbk2 UTSW 2 120748960 missense probably benign 0.00
R0362:Ttbk2 UTSW 2 120745783 missense possibly damaging 0.90
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R0906:Ttbk2 UTSW 2 120783781 missense probably damaging 1.00
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 unclassified probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7013:Ttbk2 UTSW 2 120745784 missense possibly damaging 0.89
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
R7475:Ttbk2 UTSW 2 120748640 missense probably benign 0.01
R7891:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
R7974:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
RF021:Ttbk2 UTSW 2 120748634 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCGACCACTGCTGTCATATGTATG -3'
(R):5'- AAGGCAGTTCAAGTCTTTCCTG -3'

Sequencing Primer
(F):5'- CCACTGCTGTCATATGTATGGTAAAG -3'
(R):5'- CAGTTCAAGTCTTTCCTGGGAGAC -3'
Posted On2016-04-27