Incidental Mutation 'R0401:Zfhx4'
ID 38181
Institutional Source Beutler Lab
Gene Symbol Zfhx4
Ensembl Gene ENSMUSG00000025255
Gene Name zinc finger homeodomain 4
Synonyms Zfh-4, Zfh4, C130041O22Rik
MMRRC Submission 038606-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.663) question?
Stock # R0401 (G1)
Quality Score 217
Status Validated
Chromosome 3
Chromosomal Location 5283586-5480917 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5466221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 2126 (S2126R)
Ref Sequence ENSEMBL: ENSMUSP00000135289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026284
AA Change: S2126R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: S2126R

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175866
AA Change: S2151R

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: S2151R

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 902 923 2.44e2 SMART
ZnF_U1 938 972 2.88e0 SMART
ZnF_C2H2 941 965 1.23e0 SMART
ZnF_C2H2 997 1019 7.05e-1 SMART
ZnF_U1 1042 1076 3.73e0 SMART
ZnF_C2H2 1045 1069 4.98e-1 SMART
ZnF_C2H2 1213 1236 1.1e-2 SMART
ZnF_C2H2 1242 1265 4.94e0 SMART
ZnF_C2H2 1393 1415 7.67e-2 SMART
ZnF_C2H2 1421 1444 1.33e-1 SMART
ZnF_U1 1534 1568 7.4e-1 SMART
ZnF_C2H2 1537 1561 8.22e-2 SMART
ZnF_U1 1586 1620 3.73e0 SMART
ZnF_C2H2 1589 1613 1.16e-1 SMART
low complexity region 1689 1717 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1787 1833 N/A INTRINSIC
ZnF_C2H2 1941 1964 3.07e-1 SMART
low complexity region 1989 2015 N/A INTRINSIC
low complexity region 2033 2057 N/A INTRINSIC
low complexity region 2080 2097 N/A INTRINSIC
HOX 2125 2187 4.23e-16 SMART
HOX 2222 2284 5.62e-21 SMART
ZnF_C2H2 2308 2328 1.13e1 SMART
low complexity region 2389 2401 N/A INTRINSIC
low complexity region 2433 2450 N/A INTRINSIC
low complexity region 2474 2485 N/A INTRINSIC
ZnF_C2H2 2486 2508 2.17e-1 SMART
HOX 2598 2660 3.18e-20 SMART
ZnF_C2H2 2668 2691 6.67e-2 SMART
low complexity region 2899 2911 N/A INTRINSIC
HOX 2921 2983 4.54e-16 SMART
ZnF_U1 2996 3030 6.59e-1 SMART
ZnF_C2H2 2999 3023 1.36e1 SMART
low complexity region 3091 3103 N/A INTRINSIC
low complexity region 3131 3144 N/A INTRINSIC
low complexity region 3188 3211 N/A INTRINSIC
coiled coil region 3304 3333 N/A INTRINSIC
ZnF_C2H2 3393 3413 1.12e2 SMART
ZnF_U1 3434 3468 6.16e-2 SMART
ZnF_C2H2 3437 3461 6.57e0 SMART
low complexity region 3486 3504 N/A INTRINSIC
low complexity region 3530 3552 N/A INTRINSIC
low complexity region 3561 3572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176383
AA Change: S2126R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: S2126R

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,776,067 (GRCm39) H1752L possibly damaging Het
Abcc5 T C 16: 20,195,308 (GRCm39) K730E probably benign Het
Ahnak A G 19: 8,992,480 (GRCm39) D4588G probably benign Het
AI467606 G A 7: 126,691,608 (GRCm39) R61H probably damaging Het
Apoa4 T A 9: 46,154,356 (GRCm39) V319E probably damaging Het
Ark2n C A 18: 77,761,658 (GRCm39) S218I probably damaging Het
Atad5 T A 11: 80,011,525 (GRCm39) D1297E probably benign Het
BC005624 G A 2: 30,870,021 (GRCm39) T62I probably benign Het
Bcl6 T C 16: 23,791,344 (GRCm39) K337E probably damaging Het
Cad T A 5: 31,231,330 (GRCm39) probably benign Het
Ccdc73 T C 2: 104,821,634 (GRCm39) S528P probably benign Het
Ccng2 T G 5: 93,421,272 (GRCm39) C261G possibly damaging Het
Cdh11 A T 8: 103,400,638 (GRCm39) I110N probably damaging Het
Cgnl1 A G 9: 71,612,521 (GRCm39) V767A probably damaging Het
Cit A G 5: 116,123,538 (GRCm39) T1460A probably benign Het
Clec4b2 C T 6: 123,158,259 (GRCm39) Q42* probably null Het
Clip1 A G 5: 123,791,852 (GRCm39) V106A probably damaging Het
Crb1 T C 1: 139,126,529 (GRCm39) probably benign Het
Cts6 T C 13: 61,346,153 (GRCm39) probably benign Het
Cul9 T C 17: 46,852,630 (GRCm39) E244G probably damaging Het
Dcaf8l C A X: 88,448,815 (GRCm39) R438L probably benign Het
Ddx55 A T 5: 124,706,014 (GRCm39) I480F probably damaging Het
Dixdc1 A G 9: 50,604,974 (GRCm39) S17P possibly damaging Het
Drosha T A 15: 12,926,117 (GRCm39) Y1235* probably null Het
Dsg2 G T 18: 20,725,565 (GRCm39) probably benign Het
E2f5 T C 3: 14,644,085 (GRCm39) probably null Het
Epc2 A G 2: 49,418,986 (GRCm39) T265A probably damaging Het
Etaa1 T G 11: 17,897,514 (GRCm39) D201A probably damaging Het
Fancd2 T C 6: 113,525,304 (GRCm39) I260T possibly damaging Het
Fhdc1 G A 3: 84,351,931 (GRCm39) A1098V probably benign Het
Gpd2 G A 2: 57,230,105 (GRCm39) V286I possibly damaging Het
Gpr141b A T 13: 19,913,664 (GRCm39) noncoding transcript Het
H2-T9 C T 17: 36,439,597 (GRCm39) V128M probably damaging Het
Herc2 A C 7: 55,807,480 (GRCm39) E2523A probably damaging Het
Irag1 G A 7: 110,476,104 (GRCm39) P757S probably benign Het
Jmjd1c G A 10: 67,056,161 (GRCm39) R527H probably damaging Het
Kif12 G A 4: 63,087,762 (GRCm39) probably benign Het
Lrp2 A T 2: 69,309,492 (GRCm39) N2802K probably damaging Het
Mab21l2 C G 3: 86,454,296 (GRCm39) G235R probably benign Het
Mapk8 T C 14: 33,104,165 (GRCm39) E417G probably benign Het
Mapk8ip3 G A 17: 25,128,145 (GRCm39) probably benign Het
Mettl1 A G 10: 126,880,946 (GRCm39) T203A probably benign Het
Mettl9 T C 7: 120,675,536 (GRCm39) V312A probably damaging Het
Mex3d A G 10: 80,222,728 (GRCm39) V176A probably benign Het
Mmp3 T C 9: 7,449,790 (GRCm39) S225P probably damaging Het
Neb G A 2: 52,078,689 (GRCm39) probably benign Het
Ninj2 C T 6: 120,175,012 (GRCm39) A51V possibly damaging Het
Nle1 A G 11: 82,796,205 (GRCm39) probably benign Het
Nol9 T C 4: 152,137,062 (GRCm39) Y532H probably benign Het
Nr2c1 T A 10: 94,007,020 (GRCm39) V286E probably benign Het
Or4b1b A T 2: 90,112,748 (GRCm39) M57K probably damaging Het
Or4c31 T G 2: 88,292,269 (GRCm39) L195R probably damaging Het
Or52e18 T A 7: 104,609,150 (GRCm39) H263L probably damaging Het
Or5p4 T A 7: 107,680,079 (GRCm39) I26N possibly damaging Het
Or6c69 A G 10: 129,747,785 (GRCm39) Y121H probably benign Het
Or6f1 T C 7: 85,970,500 (GRCm39) Y220C probably benign Het
Or9k7 A G 10: 130,046,489 (GRCm39) L170P probably damaging Het
Ovch2 A T 7: 107,400,343 (GRCm39) V15D probably damaging Het
Pate8 G T 9: 36,493,924 (GRCm39) A3E unknown Het
Pclo T G 5: 14,731,748 (GRCm39) S3417A unknown Het
Pex1 T A 5: 3,683,759 (GRCm39) M1085K probably damaging Het
Plscr2 T C 9: 92,164,188 (GRCm39) S6P probably benign Het
Pogz C T 3: 94,784,336 (GRCm39) P722S possibly damaging Het
Pom121l2 A T 13: 22,166,395 (GRCm39) D222V probably benign Het
Prpf40a T C 2: 53,049,325 (GRCm39) Y179C probably damaging Het
R3hdm2 A G 10: 127,294,042 (GRCm39) I179V possibly damaging Het
Ranbp9 A C 13: 43,576,134 (GRCm39) V355G probably damaging Het
Rims2 T C 15: 39,373,028 (GRCm39) probably benign Het
Ryr2 A T 13: 11,720,570 (GRCm39) S2693T probably benign Het
Sbno1 G A 5: 124,548,348 (GRCm39) T111I probably damaging Het
Sdk1 A C 5: 142,031,916 (GRCm39) N997T possibly damaging Het
Setx G T 2: 29,056,301 (GRCm39) E39* probably null Het
Skint7 T A 4: 111,837,559 (GRCm39) N112K probably damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 A T 2: 62,021,192 (GRCm39) D80V probably benign Het
Susd2 C A 10: 75,474,437 (GRCm39) probably benign Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Tcf3 G T 10: 80,256,992 (GRCm39) S77R probably damaging Het
Tdpoz3 T C 3: 93,733,672 (GRCm39) Y116H probably benign Het
Tex26 C A 5: 149,384,323 (GRCm39) D164E probably benign Het
Thoc5 G A 11: 4,852,213 (GRCm39) probably benign Het
Tiparp A G 3: 65,438,857 (GRCm39) R58G probably benign Het
Trim66 A T 7: 109,074,471 (GRCm39) C597S probably damaging Het
Ugt2a3 T A 5: 87,484,349 (GRCm39) Q225L probably benign Het
Vmn1r25 T A 6: 57,955,696 (GRCm39) I198L probably benign Het
Vmn2r106 A T 17: 20,499,281 (GRCm39) V210D possibly damaging Het
Vmn2r124 T C 17: 18,284,407 (GRCm39) F483L probably damaging Het
Vmn2r78 A G 7: 86,570,519 (GRCm39) K346E probably benign Het
Zfp608 C T 18: 55,032,066 (GRCm39) G625R probably benign Het
Zkscan5 A G 5: 145,149,385 (GRCm39) D234G probably damaging Het
Zscan10 T A 17: 23,824,889 (GRCm39) V115E probably damaging Het
Other mutations in Zfhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfhx4 APN 3 5,307,401 (GRCm39) missense probably damaging 1.00
IGL00915:Zfhx4 APN 3 5,310,583 (GRCm39) missense probably damaging 0.99
IGL01145:Zfhx4 APN 3 5,310,407 (GRCm39) missense probably damaging 1.00
IGL01302:Zfhx4 APN 3 5,308,628 (GRCm39) missense probably damaging 1.00
IGL01314:Zfhx4 APN 3 5,478,154 (GRCm39) missense probably damaging 0.98
IGL01321:Zfhx4 APN 3 5,307,388 (GRCm39) missense probably benign 0.01
IGL01328:Zfhx4 APN 3 5,309,344 (GRCm39) missense probably damaging 1.00
IGL01333:Zfhx4 APN 3 5,464,387 (GRCm39) missense probably damaging 1.00
IGL01351:Zfhx4 APN 3 5,466,196 (GRCm39) missense probably damaging 1.00
IGL01524:Zfhx4 APN 3 5,309,036 (GRCm39) missense probably damaging 1.00
IGL01549:Zfhx4 APN 3 5,464,522 (GRCm39) missense probably damaging 1.00
IGL01715:Zfhx4 APN 3 5,307,105 (GRCm39) missense probably benign 0.00
IGL01736:Zfhx4 APN 3 5,309,152 (GRCm39) missense possibly damaging 0.85
IGL01904:Zfhx4 APN 3 5,477,769 (GRCm39) missense probably damaging 1.00
IGL02298:Zfhx4 APN 3 5,309,364 (GRCm39) splice site probably null
IGL02342:Zfhx4 APN 3 5,467,434 (GRCm39) missense probably benign 0.14
IGL02465:Zfhx4 APN 3 5,464,663 (GRCm39) missense possibly damaging 0.48
IGL02481:Zfhx4 APN 3 5,476,903 (GRCm39) missense probably damaging 0.99
IGL02511:Zfhx4 APN 3 5,464,243 (GRCm39) missense probably damaging 1.00
IGL02571:Zfhx4 APN 3 5,394,583 (GRCm39) missense probably damaging 1.00
IGL02685:Zfhx4 APN 3 5,477,213 (GRCm39) missense probably damaging 1.00
IGL02721:Zfhx4 APN 3 5,308,367 (GRCm39) missense possibly damaging 0.76
IGL02806:Zfhx4 APN 3 5,455,468 (GRCm39) missense probably benign 0.00
IGL03140:Zfhx4 APN 3 5,307,585 (GRCm39) missense probably damaging 1.00
IGL03185:Zfhx4 APN 3 5,468,974 (GRCm39) missense probably benign 0.05
IGL03209:Zfhx4 APN 3 5,466,231 (GRCm39) missense probably damaging 1.00
IGL03292:Zfhx4 APN 3 5,476,840 (GRCm39) nonsense probably null
IGL03302:Zfhx4 APN 3 5,468,773 (GRCm39) missense possibly damaging 0.88
IGL03303:Zfhx4 APN 3 5,468,410 (GRCm39) missense probably damaging 1.00
IGL03341:Zfhx4 APN 3 5,476,910 (GRCm39) missense probably damaging 0.98
3-1:Zfhx4 UTSW 3 5,468,445 (GRCm39) missense probably benign 0.14
B5639:Zfhx4 UTSW 3 5,468,235 (GRCm39) missense probably damaging 0.99
IGL02796:Zfhx4 UTSW 3 5,464,599 (GRCm39) missense probably damaging 1.00
IGL03047:Zfhx4 UTSW 3 5,308,793 (GRCm39) missense probably damaging 0.99
P0025:Zfhx4 UTSW 3 5,464,648 (GRCm39) missense probably benign 0.04
PIT4377001:Zfhx4 UTSW 3 5,307,802 (GRCm39) missense probably damaging 0.98
R0090:Zfhx4 UTSW 3 5,308,685 (GRCm39) missense probably damaging 1.00
R0107:Zfhx4 UTSW 3 5,464,042 (GRCm39) missense probably damaging 1.00
R0465:Zfhx4 UTSW 3 5,310,716 (GRCm39) splice site probably benign
R0506:Zfhx4 UTSW 3 5,467,795 (GRCm39) missense probably damaging 1.00
R0507:Zfhx4 UTSW 3 5,466,048 (GRCm39) nonsense probably null
R0550:Zfhx4 UTSW 3 5,465,554 (GRCm39) missense probably damaging 0.99
R0576:Zfhx4 UTSW 3 5,467,161 (GRCm39) missense probably damaging 1.00
R0590:Zfhx4 UTSW 3 5,467,693 (GRCm39) missense probably damaging 1.00
R0697:Zfhx4 UTSW 3 5,466,793 (GRCm39) missense probably damaging 0.99
R0727:Zfhx4 UTSW 3 5,466,133 (GRCm39) missense probably damaging 0.98
R0762:Zfhx4 UTSW 3 5,468,880 (GRCm39) missense probably damaging 1.00
R0815:Zfhx4 UTSW 3 5,310,375 (GRCm39) missense possibly damaging 0.87
R0863:Zfhx4 UTSW 3 5,310,375 (GRCm39) missense possibly damaging 0.87
R0866:Zfhx4 UTSW 3 5,477,272 (GRCm39) missense possibly damaging 0.58
R1109:Zfhx4 UTSW 3 5,464,930 (GRCm39) missense possibly damaging 0.59
R1177:Zfhx4 UTSW 3 5,465,891 (GRCm39) small deletion probably benign
R1338:Zfhx4 UTSW 3 5,462,021 (GRCm39) missense possibly damaging 0.86
R1388:Zfhx4 UTSW 3 5,466,447 (GRCm39) missense probably damaging 1.00
R1434:Zfhx4 UTSW 3 5,306,919 (GRCm39) missense probably benign 0.00
R1470:Zfhx4 UTSW 3 5,478,206 (GRCm39) makesense probably null
R1470:Zfhx4 UTSW 3 5,478,206 (GRCm39) makesense probably null
R1552:Zfhx4 UTSW 3 5,468,170 (GRCm39) missense probably damaging 1.00
R1589:Zfhx4 UTSW 3 5,306,789 (GRCm39) missense probably damaging 1.00
R1633:Zfhx4 UTSW 3 5,465,473 (GRCm39) missense probably damaging 1.00
R1656:Zfhx4 UTSW 3 5,478,076 (GRCm39) missense probably damaging 1.00
R1717:Zfhx4 UTSW 3 5,468,164 (GRCm39) missense probably benign 0.20
R1739:Zfhx4 UTSW 3 5,466,790 (GRCm39) missense probably damaging 1.00
R1760:Zfhx4 UTSW 3 5,447,676 (GRCm39) missense probably benign
R1842:Zfhx4 UTSW 3 5,466,558 (GRCm39) missense probably damaging 1.00
R1867:Zfhx4 UTSW 3 5,477,774 (GRCm39) missense probably damaging 1.00
R1868:Zfhx4 UTSW 3 5,477,774 (GRCm39) missense probably damaging 1.00
R2064:Zfhx4 UTSW 3 5,463,987 (GRCm39) missense probably damaging 1.00
R2083:Zfhx4 UTSW 3 5,468,223 (GRCm39) missense possibly damaging 0.58
R2154:Zfhx4 UTSW 3 5,466,801 (GRCm39) missense possibly damaging 0.86
R2165:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R2181:Zfhx4 UTSW 3 5,468,392 (GRCm39) missense probably damaging 1.00
R2201:Zfhx4 UTSW 3 5,307,349 (GRCm39) missense probably damaging 1.00
R2209:Zfhx4 UTSW 3 5,461,978 (GRCm39) missense probably damaging 1.00
R2303:Zfhx4 UTSW 3 5,462,120 (GRCm39) missense probably damaging 0.99
R2327:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R2420:Zfhx4 UTSW 3 5,455,465 (GRCm39) missense probably benign 0.00
R2422:Zfhx4 UTSW 3 5,455,465 (GRCm39) missense probably benign 0.00
R2516:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R2518:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R2519:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R2520:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R2566:Zfhx4 UTSW 3 5,310,203 (GRCm39) missense probably damaging 0.98
R2922:Zfhx4 UTSW 3 5,468,724 (GRCm39) missense probably damaging 1.00
R3000:Zfhx4 UTSW 3 5,468,714 (GRCm39) missense probably damaging 1.00
R3103:Zfhx4 UTSW 3 5,464,386 (GRCm39) missense probably damaging 1.00
R3409:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R3414:Zfhx4 UTSW 3 5,468,883 (GRCm39) missense probably damaging 1.00
R3746:Zfhx4 UTSW 3 5,308,225 (GRCm39) missense possibly damaging 0.82
R3747:Zfhx4 UTSW 3 5,308,225 (GRCm39) missense possibly damaging 0.82
R3748:Zfhx4 UTSW 3 5,308,225 (GRCm39) missense possibly damaging 0.82
R3749:Zfhx4 UTSW 3 5,308,225 (GRCm39) missense possibly damaging 0.82
R3750:Zfhx4 UTSW 3 5,308,225 (GRCm39) missense possibly damaging 0.82
R3763:Zfhx4 UTSW 3 5,468,404 (GRCm39) missense probably damaging 1.00
R3826:Zfhx4 UTSW 3 5,466,269 (GRCm39) missense probably damaging 1.00
R3827:Zfhx4 UTSW 3 5,466,269 (GRCm39) missense probably damaging 1.00
R3830:Zfhx4 UTSW 3 5,466,269 (GRCm39) missense probably damaging 1.00
R3877:Zfhx4 UTSW 3 5,465,845 (GRCm39) missense probably benign
R3919:Zfhx4 UTSW 3 5,464,175 (GRCm39) missense possibly damaging 0.48
R3922:Zfhx4 UTSW 3 5,465,707 (GRCm39) missense probably damaging 1.00
R3927:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R3965:Zfhx4 UTSW 3 5,468,907 (GRCm39) missense probably damaging 1.00
R4004:Zfhx4 UTSW 3 5,468,418 (GRCm39) missense probably benign 0.32
R4049:Zfhx4 UTSW 3 5,463,919 (GRCm39) missense probably damaging 1.00
R4073:Zfhx4 UTSW 3 5,464,384 (GRCm39) missense probably damaging 1.00
R4134:Zfhx4 UTSW 3 5,308,687 (GRCm39) missense probably damaging 1.00
R4401:Zfhx4 UTSW 3 5,468,405 (GRCm39) nonsense probably null
R4439:Zfhx4 UTSW 3 5,279,875 (GRCm39) unclassified probably benign
R4497:Zfhx4 UTSW 3 5,464,680 (GRCm39) missense possibly damaging 0.88
R4518:Zfhx4 UTSW 3 5,477,578 (GRCm39) missense probably damaging 1.00
R4569:Zfhx4 UTSW 3 5,466,894 (GRCm39) missense probably benign 0.00
R4612:Zfhx4 UTSW 3 5,462,123 (GRCm39) missense probably damaging 1.00
R4616:Zfhx4 UTSW 3 5,478,127 (GRCm39) missense possibly damaging 0.66
R4626:Zfhx4 UTSW 3 5,467,699 (GRCm39) missense probably damaging 1.00
R4628:Zfhx4 UTSW 3 5,468,536 (GRCm39) missense probably damaging 1.00
R4637:Zfhx4 UTSW 3 5,468,464 (GRCm39) missense probably damaging 1.00
R4647:Zfhx4 UTSW 3 5,464,341 (GRCm39) missense probably damaging 0.99
R4708:Zfhx4 UTSW 3 5,310,563 (GRCm39) splice site probably null
R4729:Zfhx4 UTSW 3 5,464,557 (GRCm39) missense probably damaging 1.00
R4732:Zfhx4 UTSW 3 5,279,867 (GRCm39) unclassified probably benign
R4757:Zfhx4 UTSW 3 5,465,122 (GRCm39) missense possibly damaging 0.85
R4765:Zfhx4 UTSW 3 5,465,212 (GRCm39) missense probably benign
R4819:Zfhx4 UTSW 3 5,468,974 (GRCm39) missense probably benign 0.05
R4937:Zfhx4 UTSW 3 5,307,071 (GRCm39) missense probably damaging 1.00
R4980:Zfhx4 UTSW 3 5,464,039 (GRCm39) missense possibly damaging 0.47
R5124:Zfhx4 UTSW 3 5,307,107 (GRCm39) missense probably damaging 1.00
R5214:Zfhx4 UTSW 3 5,468,701 (GRCm39) missense probably damaging 1.00
R5361:Zfhx4 UTSW 3 5,464,267 (GRCm39) missense probably damaging 0.99
R5375:Zfhx4 UTSW 3 5,477,485 (GRCm39) missense probably damaging 0.99
R5485:Zfhx4 UTSW 3 5,308,067 (GRCm39) missense probably damaging 1.00
R5588:Zfhx4 UTSW 3 5,468,198 (GRCm39) missense probably damaging 1.00
R5609:Zfhx4 UTSW 3 5,468,679 (GRCm39) missense probably damaging 1.00
R5726:Zfhx4 UTSW 3 5,468,381 (GRCm39) missense probably benign 0.02
R5758:Zfhx4 UTSW 3 5,467,680 (GRCm39) missense probably damaging 1.00
R5865:Zfhx4 UTSW 3 5,467,719 (GRCm39) missense probably damaging 1.00
R5938:Zfhx4 UTSW 3 5,467,198 (GRCm39) missense probably damaging 0.99
R5952:Zfhx4 UTSW 3 5,462,030 (GRCm39) missense probably damaging 0.99
R6043:Zfhx4 UTSW 3 5,468,487 (GRCm39) missense probably benign 0.00
R6045:Zfhx4 UTSW 3 5,462,019 (GRCm39) missense probably damaging 1.00
R6125:Zfhx4 UTSW 3 5,463,871 (GRCm39) missense possibly damaging 0.68
R6354:Zfhx4 UTSW 3 5,467,011 (GRCm39) missense probably benign
R6374:Zfhx4 UTSW 3 5,309,095 (GRCm39) missense probably damaging 1.00
R6378:Zfhx4 UTSW 3 5,308,410 (GRCm39) missense probably benign 0.07
R6380:Zfhx4 UTSW 3 5,478,170 (GRCm39) missense probably damaging 0.99
R6413:Zfhx4 UTSW 3 5,308,205 (GRCm39) missense probably damaging 1.00
R6449:Zfhx4 UTSW 3 5,307,488 (GRCm39) missense probably damaging 1.00
R6539:Zfhx4 UTSW 3 5,309,168 (GRCm39) missense probably damaging 0.99
R6714:Zfhx4 UTSW 3 5,306,897 (GRCm39) missense probably damaging 1.00
R6933:Zfhx4 UTSW 3 5,478,047 (GRCm39) missense probably damaging 0.99
R6982:Zfhx4 UTSW 3 5,468,890 (GRCm39) missense probably damaging 1.00
R7104:Zfhx4 UTSW 3 5,467,549 (GRCm39) missense probably damaging 0.97
R7127:Zfhx4 UTSW 3 5,478,104 (GRCm39) missense probably damaging 0.99
R7138:Zfhx4 UTSW 3 5,477,107 (GRCm39) missense possibly damaging 0.69
R7161:Zfhx4 UTSW 3 5,309,143 (GRCm39) missense possibly damaging 0.65
R7213:Zfhx4 UTSW 3 5,461,704 (GRCm39) missense probably benign
R7483:Zfhx4 UTSW 3 5,477,237 (GRCm39) missense probably damaging 0.98
R7514:Zfhx4 UTSW 3 5,307,267 (GRCm39) missense possibly damaging 0.91
R7544:Zfhx4 UTSW 3 5,477,875 (GRCm39) missense probably damaging 0.98
R7565:Zfhx4 UTSW 3 5,455,426 (GRCm39) missense probably benign 0.04
R7611:Zfhx4 UTSW 3 5,468,831 (GRCm39) missense probably damaging 1.00
R7640:Zfhx4 UTSW 3 5,477,540 (GRCm39) missense probably benign 0.19
R7649:Zfhx4 UTSW 3 5,307,170 (GRCm39) missense probably damaging 1.00
R7689:Zfhx4 UTSW 3 5,476,946 (GRCm39) missense probably benign 0.05
R7711:Zfhx4 UTSW 3 5,462,016 (GRCm39) missense probably damaging 0.98
R7895:Zfhx4 UTSW 3 5,307,259 (GRCm39) missense probably benign 0.00
R7920:Zfhx4 UTSW 3 5,465,515 (GRCm39) missense possibly damaging 0.62
R7972:Zfhx4 UTSW 3 5,477,533 (GRCm39) missense probably benign 0.02
R7993:Zfhx4 UTSW 3 5,478,047 (GRCm39) missense probably damaging 1.00
R8133:Zfhx4 UTSW 3 5,465,554 (GRCm39) missense probably damaging 0.99
R8158:Zfhx4 UTSW 3 5,464,010 (GRCm39) nonsense probably null
R8272:Zfhx4 UTSW 3 5,308,927 (GRCm39) missense probably damaging 0.99
R8285:Zfhx4 UTSW 3 5,466,916 (GRCm39) missense probably benign 0.17
R8321:Zfhx4 UTSW 3 5,466,187 (GRCm39) missense probably damaging 1.00
R8381:Zfhx4 UTSW 3 5,447,676 (GRCm39) missense probably benign 0.00
R8434:Zfhx4 UTSW 3 5,463,918 (GRCm39) missense probably damaging 0.99
R8466:Zfhx4 UTSW 3 5,307,762 (GRCm39) missense probably damaging 1.00
R8515:Zfhx4 UTSW 3 5,464,534 (GRCm39) missense probably benign 0.00
R8525:Zfhx4 UTSW 3 5,464,603 (GRCm39) missense probably damaging 1.00
R8743:Zfhx4 UTSW 3 5,309,084 (GRCm39) missense probably damaging 1.00
R8830:Zfhx4 UTSW 3 5,463,949 (GRCm39) missense probably damaging 1.00
R8839:Zfhx4 UTSW 3 5,466,915 (GRCm39) missense probably benign
R8856:Zfhx4 UTSW 3 5,455,484 (GRCm39) missense probably benign 0.45
R8900:Zfhx4 UTSW 3 5,463,924 (GRCm39) missense probably damaging 1.00
R8917:Zfhx4 UTSW 3 5,464,159 (GRCm39) missense probably damaging 1.00
R9101:Zfhx4 UTSW 3 5,477,198 (GRCm39) missense probably benign 0.10
R9126:Zfhx4 UTSW 3 5,394,589 (GRCm39) missense probably damaging 0.99
R9159:Zfhx4 UTSW 3 5,466,217 (GRCm39) missense probably damaging 1.00
R9159:Zfhx4 UTSW 3 5,464,312 (GRCm39) missense probably damaging 0.98
R9241:Zfhx4 UTSW 3 5,308,697 (GRCm39) missense probably damaging 1.00
R9295:Zfhx4 UTSW 3 5,394,525 (GRCm39) missense probably benign
R9376:Zfhx4 UTSW 3 5,465,395 (GRCm39) missense probably benign 0.04
R9376:Zfhx4 UTSW 3 5,306,833 (GRCm39) missense probably damaging 1.00
R9550:Zfhx4 UTSW 3 5,464,572 (GRCm39) missense probably damaging 1.00
R9680:Zfhx4 UTSW 3 5,465,656 (GRCm39) missense probably damaging 1.00
R9782:Zfhx4 UTSW 3 5,466,514 (GRCm39) missense probably benign 0.38
R9787:Zfhx4 UTSW 3 5,455,506 (GRCm39) missense possibly damaging 0.94
R9790:Zfhx4 UTSW 3 5,464,922 (GRCm39) missense probably damaging 1.00
R9791:Zfhx4 UTSW 3 5,464,922 (GRCm39) missense probably damaging 1.00
RF019:Zfhx4 UTSW 3 5,468,327 (GRCm39) missense probably benign 0.08
X0025:Zfhx4 UTSW 3 5,476,896 (GRCm39) missense probably damaging 0.99
X0026:Zfhx4 UTSW 3 5,477,398 (GRCm39) missense probably benign 0.00
X0028:Zfhx4 UTSW 3 5,468,327 (GRCm39) missense probably damaging 1.00
X0028:Zfhx4 UTSW 3 5,467,474 (GRCm39) missense probably benign 0.13
X0054:Zfhx4 UTSW 3 5,464,770 (GRCm39) nonsense probably null
Z1177:Zfhx4 UTSW 3 5,307,506 (GRCm39) missense probably damaging 1.00
Z1187:Zfhx4 UTSW 3 5,308,067 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAACACAGTATCTGCTCCTCTGC -3'
(R):5'- CCTGGATGATCTTTTGCTGAATGCG -3'

Sequencing Primer
(F):5'- cctcctcctcctcctcctc -3'
(R):5'- ATCTTTTGCTGAATGCGGCATC -3'
Posted On 2013-05-23