Mutagenetix > Incidental Mutation

Incidental Mutation 'R0401:Zfhx4'

38181

Institutional Source

Beutler Lab

Gene Symbol

Zfhx4

Ensembl Gene

ENSMUSG00000025255

Gene Name

zinc finger homeodomain 4

Synonyms

Zfh4, C130041O22Rik, Zfh-4

MMRRC Submission

038606-MU

Accession Numbers

Genbank: NM_030708; MGI: 2137668

Essential gene?

Possibly essential (E-score: 0.619) question?

Stock #

R0401 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

5218526-5415857 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 5401161 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 2126 (S2126R)

Ref Sequence

ENSEMBL: ENSMUSP00000135289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026284
AA Change: S2126R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: S2126R

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000175866
AA Change: S2151R

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: S2151R

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	902	923	2.44e2	SMART
ZnF_U1	938	972	2.88e0	SMART
ZnF_C2H2	941	965	1.23e0	SMART
ZnF_C2H2	997	1019	7.05e-1	SMART
ZnF_U1	1042	1076	3.73e0	SMART
ZnF_C2H2	1045	1069	4.98e-1	SMART
ZnF_C2H2	1213	1236	1.1e-2	SMART
ZnF_C2H2	1242	1265	4.94e0	SMART
ZnF_C2H2	1393	1415	7.67e-2	SMART
ZnF_C2H2	1421	1444	1.33e-1	SMART
ZnF_U1	1534	1568	7.4e-1	SMART
ZnF_C2H2	1537	1561	8.22e-2	SMART
ZnF_U1	1586	1620	3.73e0	SMART
ZnF_C2H2	1589	1613	1.16e-1	SMART
low complexity region	1689	1717	N/A	INTRINSIC
low complexity region	1726	1738	N/A	INTRINSIC
low complexity region	1787	1833	N/A	INTRINSIC
ZnF_C2H2	1941	1964	3.07e-1	SMART
low complexity region	1989	2015	N/A	INTRINSIC
low complexity region	2033	2057	N/A	INTRINSIC
low complexity region	2080	2097	N/A	INTRINSIC
HOX	2125	2187	4.23e-16	SMART
HOX	2222	2284	5.62e-21	SMART
ZnF_C2H2	2308	2328	1.13e1	SMART
low complexity region	2389	2401	N/A	INTRINSIC
low complexity region	2433	2450	N/A	INTRINSIC
low complexity region	2474	2485	N/A	INTRINSIC
ZnF_C2H2	2486	2508	2.17e-1	SMART
HOX	2598	2660	3.18e-20	SMART
ZnF_C2H2	2668	2691	6.67e-2	SMART
low complexity region	2899	2911	N/A	INTRINSIC
HOX	2921	2983	4.54e-16	SMART
ZnF_U1	2996	3030	6.59e-1	SMART
ZnF_C2H2	2999	3023	1.36e1	SMART
low complexity region	3091	3103	N/A	INTRINSIC
low complexity region	3131	3144	N/A	INTRINSIC
low complexity region	3188	3211	N/A	INTRINSIC
coiled coil region	3304	3333	N/A	INTRINSIC
ZnF_C2H2	3393	3413	1.12e2	SMART
ZnF_U1	3434	3468	6.16e-2	SMART
ZnF_C2H2	3437	3461	6.57e0	SMART
low complexity region	3486	3504	N/A	INTRINSIC
low complexity region	3530	3552	N/A	INTRINSIC
low complexity region	3561	3572	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176383
AA Change: S2126R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: S2126R

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Meta Mutation Damage Score

0.0614

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.6%

Validation Efficiency

98% (90/92)

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,070,306	H1752L	possibly damaging	Het
8030462N17Rik	C	A	18: 77,673,962	S218I	probably damaging	Het
A530099J19Rik	A	T	13: 19,729,494		noncoding transcript	Het
Abcc5	T	C	16: 20,376,558	K730E	probably benign	Het
Ahnak	A	G	19: 9,015,116	D4588G	probably benign	Het
AI467606	G	A	7: 127,092,436	R61H	probably damaging	Het
Apoa4	T	A	9: 46,243,058	V319E	probably damaging	Het
Atad5	T	A	11: 80,120,699	D1297E	probably benign	Het
BC005624	G	A	2: 30,980,009	T62I	probably benign	Het
Bcl6	T	C	16: 23,972,594	K337E	probably damaging	Het
Cad	T	A	5: 31,073,986		probably benign	Het
Ccdc73	T	C	2: 104,991,289	S528P	probably benign	Het
Ccng2	T	G	5: 93,273,413	C261G	possibly damaging	Het
Cdh11	A	T	8: 102,674,006	I110N	probably damaging	Het
Cgnl1	A	G	9: 71,705,239	V767A	probably damaging	Het
Cit	A	G	5: 115,985,479	T1460A	probably benign	Het
Clec4b2	C	T	6: 123,181,300	Q42*	probably null	Het
Clip1	A	G	5: 123,653,789	V106A	probably damaging	Het
Crb1	T	C	1: 139,198,791		probably benign	Het
Cts6	T	C	13: 61,198,339		probably benign	Het
Cul9	T	C	17: 46,541,704	E244G	probably damaging	Het
Ddx55	A	T	5: 124,567,951	I480F	probably damaging	Het
Dixdc1	A	G	9: 50,693,674	S17P	possibly damaging	Het
Drosha	T	A	15: 12,926,031	Y1235*	probably null	Het
Dsg2	G	T	18: 20,592,508		probably benign	Het
E2f5	T	C	3: 14,579,025		probably null	Het
Epc2	A	G	2: 49,528,974	T265A	probably damaging	Het
Etaa1	T	G	11: 17,947,514	D201A	probably damaging	Het
Fancd2	T	C	6: 113,548,343	I260T	possibly damaging	Het
Fhdc1	G	A	3: 84,444,624	A1098V	probably benign	Het
Gm17689	G	T	9: 36,582,628	A3E	unknown	Het
Gm7030	C	T	17: 36,128,705	V128M	probably damaging	Het
Gpd2	G	A	2: 57,340,093	V286I	possibly damaging	Het
Herc2	A	C	7: 56,157,732	E2523A	probably damaging	Het
Jmjd1c	G	A	10: 67,220,382	R527H	probably damaging	Het
Kif12	G	A	4: 63,169,525		probably benign	Het
Lrp2	A	T	2: 69,479,148	N2802K	probably damaging	Het
Mab21l2	C	G	3: 86,546,989	G235R	probably benign	Het
Mapk8	T	C	14: 33,382,208	E417G	probably benign	Het
Mapk8ip3	G	A	17: 24,909,171		probably benign	Het
Mettl1	A	G	10: 127,045,077	T203A	probably benign	Het
Mettl9	T	C	7: 121,076,313	V312A	probably damaging	Het
Mex3d	A	G	10: 80,386,894	V176A	probably benign	Het
Mmp3	T	C	9: 7,449,790	S225P	probably damaging	Het
Mrvi1	G	A	7: 110,876,897	P757S	probably benign	Het
Neb	G	A	2: 52,188,677		probably benign	Het
Ninj2	C	T	6: 120,198,051	A51V	possibly damaging	Het
Nle1	A	G	11: 82,905,379		probably benign	Het
Nol9	T	C	4: 152,052,605	Y532H	probably benign	Het
Nr2c1	T	A	10: 94,171,158	V286E	probably benign	Het
Olfr1183	T	G	2: 88,461,925	L195R	probably damaging	Het
Olfr1272	A	T	2: 90,282,404	M57K	probably damaging	Het
Olfr308	T	C	7: 86,321,292	Y220C	probably benign	Het
Olfr481	T	A	7: 108,080,872	I26N	possibly damaging	Het
Olfr670	T	A	7: 104,959,943	H263L	probably damaging	Het
Olfr816	A	G	10: 129,911,916	Y121H	probably benign	Het
Olfr827	A	G	10: 130,210,620	L170P	probably damaging	Het
Ovch2	A	T	7: 107,801,136	V15D	probably damaging	Het
Pclo	T	G	5: 14,681,734	S3417A	unknown	Het
Pet2	C	A	X: 89,405,209	R438L	probably benign	Het
Pex1	T	A	5: 3,633,759	M1085K	probably damaging	Het
Plscr2	T	C	9: 92,282,135	S6P	probably benign	Het
Pogz	C	T	3: 94,877,025	P722S	possibly damaging	Het
Pom121l2	A	T	13: 21,982,225	D222V	probably benign	Het
Prpf40a	T	C	2: 53,159,313	Y179C	probably damaging	Het
R3hdm2	A	G	10: 127,458,173	I179V	possibly damaging	Het
Ranbp9	A	C	13: 43,422,658	V355G	probably damaging	Het
Rims2	T	C	15: 39,509,632		probably benign	Het
Ryr2	A	T	13: 11,705,684	S2693T	probably benign	Het
Sbno1	G	A	5: 124,410,285	T111I	probably damaging	Het
Sdk1	A	C	5: 142,046,161	N997T	possibly damaging	Het
Setx	G	T	2: 29,166,289	E39*	probably null	Het
Skint7	T	A	4: 111,980,362	N112K	probably damaging	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	A	T	2: 62,190,848	D80V	probably benign	Het
Susd2	C	A	10: 75,638,603		probably benign	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcf3	G	T	10: 80,421,158	S77R	probably damaging	Het
Tdpoz3	T	C	3: 93,826,365	Y116H	probably benign	Het
Tex26	C	A	5: 149,460,858	D164E	probably benign	Het
Thoc5	G	A	11: 4,902,213		probably benign	Het
Tiparp	A	G	3: 65,531,436	R58G	probably benign	Het
Trim66	A	T	7: 109,475,264	C597S	probably damaging	Het
Ugt2a3	T	A	5: 87,336,490	Q225L	probably benign	Het
Vmn1r25	T	A	6: 57,978,711	I198L	probably benign	Het
Vmn2r106	A	T	17: 20,279,019	V210D	possibly damaging	Het
Vmn2r124	T	C	17: 18,064,145	F483L	probably damaging	Het
Vmn2r78	A	G	7: 86,921,311	K346E	probably benign	Het
Zfp608	C	T	18: 54,898,994	G625R	probably benign	Het
Zkscan5	A	G	5: 145,212,575	D234G	probably damaging	Het
Zscan10	T	A	17: 23,605,915	V115E	probably damaging	Het

Other mutations in Zfhx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Zfhx4	APN	3	5242341	missense	probably damaging	1.00
IGL00915:Zfhx4	APN	3	5245523	missense	probably damaging	0.99
IGL01145:Zfhx4	APN	3	5245347	missense	probably damaging	1.00
IGL01302:Zfhx4	APN	3	5243568	missense	probably damaging	1.00
IGL01314:Zfhx4	APN	3	5413094	missense	probably damaging	0.98
IGL01321:Zfhx4	APN	3	5242328	missense	probably benign	0.01
IGL01328:Zfhx4	APN	3	5244284	missense	probably damaging	1.00
IGL01333:Zfhx4	APN	3	5399327	missense	probably damaging	1.00
IGL01351:Zfhx4	APN	3	5401136	missense	probably damaging	1.00
IGL01524:Zfhx4	APN	3	5243976	missense	probably damaging	1.00
IGL01549:Zfhx4	APN	3	5399462	missense	probably damaging	1.00
IGL01715:Zfhx4	APN	3	5242045	missense	probably benign	0.00
IGL01736:Zfhx4	APN	3	5244092	missense	possibly damaging	0.85
IGL01904:Zfhx4	APN	3	5412709	missense	probably damaging	1.00
IGL02298:Zfhx4	APN	3	5244304	splice site	probably null
IGL02342:Zfhx4	APN	3	5402374	missense	probably benign	0.14
IGL02465:Zfhx4	APN	3	5399603	missense	possibly damaging	0.48
IGL02481:Zfhx4	APN	3	5411843	missense	probably damaging	0.99
IGL02511:Zfhx4	APN	3	5399183	missense	probably damaging	1.00
IGL02571:Zfhx4	APN	3	5329523	missense	probably damaging	1.00
IGL02685:Zfhx4	APN	3	5412153	missense	probably damaging	1.00
IGL02721:Zfhx4	APN	3	5243307	missense	possibly damaging	0.76
IGL02806:Zfhx4	APN	3	5390408	missense	probably benign	0.00
IGL03140:Zfhx4	APN	3	5242525	missense	probably damaging	1.00
IGL03185:Zfhx4	APN	3	5403914	missense	probably benign	0.05
IGL03209:Zfhx4	APN	3	5401171	missense	probably damaging	1.00
IGL03292:Zfhx4	APN	3	5411780	nonsense	probably null
IGL03302:Zfhx4	APN	3	5403713	missense	possibly damaging	0.88
IGL03303:Zfhx4	APN	3	5403350	missense	probably damaging	1.00
IGL03341:Zfhx4	APN	3	5411850	missense	probably damaging	0.98
3-1:Zfhx4	UTSW	3	5403385	missense	probably benign	0.14
B5639:Zfhx4	UTSW	3	5403175	missense	probably damaging	0.99
IGL02796:Zfhx4	UTSW	3	5399539	missense	probably damaging	1.00
IGL03047:Zfhx4	UTSW	3	5243733	missense	probably damaging	0.99
P0025:Zfhx4	UTSW	3	5399588	missense	probably benign	0.04
PIT4377001:Zfhx4	UTSW	3	5242742	missense	probably damaging	0.98
R0090:Zfhx4	UTSW	3	5243625	missense	probably damaging	1.00
R0107:Zfhx4	UTSW	3	5398982	missense	probably damaging	1.00
R0465:Zfhx4	UTSW	3	5245656	splice site	probably benign
R0506:Zfhx4	UTSW	3	5402735	missense	probably damaging	1.00
R0507:Zfhx4	UTSW	3	5400988	nonsense	probably null
R0550:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R0576:Zfhx4	UTSW	3	5402101	missense	probably damaging	1.00
R0590:Zfhx4	UTSW	3	5402633	missense	probably damaging	1.00
R0697:Zfhx4	UTSW	3	5401733	missense	probably damaging	0.99
R0727:Zfhx4	UTSW	3	5401073	missense	probably damaging	0.98
R0762:Zfhx4	UTSW	3	5403820	missense	probably damaging	1.00
R0815:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0863:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0866:Zfhx4	UTSW	3	5412212	missense	possibly damaging	0.58
R1109:Zfhx4	UTSW	3	5399870	missense	possibly damaging	0.59
R1177:Zfhx4	UTSW	3	5400831	small deletion	probably benign
R1338:Zfhx4	UTSW	3	5396961	missense	possibly damaging	0.86
R1388:Zfhx4	UTSW	3	5401387	missense	probably damaging	1.00
R1434:Zfhx4	UTSW	3	5241859	missense	probably benign	0.00
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1552:Zfhx4	UTSW	3	5403110	missense	probably damaging	1.00
R1589:Zfhx4	UTSW	3	5241729	missense	probably damaging	1.00
R1633:Zfhx4	UTSW	3	5400413	missense	probably damaging	1.00
R1656:Zfhx4	UTSW	3	5413016	missense	probably damaging	1.00
R1717:Zfhx4	UTSW	3	5403104	missense	probably benign	0.20
R1739:Zfhx4	UTSW	3	5401730	missense	probably damaging	1.00
R1760:Zfhx4	UTSW	3	5382616	missense	probably benign
R1842:Zfhx4	UTSW	3	5401498	missense	probably damaging	1.00
R1867:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R1868:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R2064:Zfhx4	UTSW	3	5398927	missense	probably damaging	1.00
R2083:Zfhx4	UTSW	3	5403163	missense	possibly damaging	0.58
R2154:Zfhx4	UTSW	3	5401741	missense	possibly damaging	0.86
R2165:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2181:Zfhx4	UTSW	3	5403332	missense	probably damaging	1.00
R2201:Zfhx4	UTSW	3	5242289	missense	probably damaging	1.00
R2209:Zfhx4	UTSW	3	5396918	missense	probably damaging	1.00
R2303:Zfhx4	UTSW	3	5397060	missense	probably damaging	0.99
R2327:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2420:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2422:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2516:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2518:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2519:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2520:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2566:Zfhx4	UTSW	3	5245143	missense	probably damaging	0.98
R2922:Zfhx4	UTSW	3	5403664	missense	probably damaging	1.00
R3000:Zfhx4	UTSW	3	5403654	missense	probably damaging	1.00
R3103:Zfhx4	UTSW	3	5399326	missense	probably damaging	1.00
R3409:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3414:Zfhx4	UTSW	3	5403823	missense	probably damaging	1.00
R3746:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3747:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3748:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3749:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3750:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3763:Zfhx4	UTSW	3	5403344	missense	probably damaging	1.00
R3826:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3827:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3830:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3877:Zfhx4	UTSW	3	5400785	missense	probably benign
R3919:Zfhx4	UTSW	3	5399115	missense	possibly damaging	0.48
R3922:Zfhx4	UTSW	3	5400647	missense	probably damaging	1.00
R3927:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3965:Zfhx4	UTSW	3	5403847	missense	probably damaging	1.00
R4004:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R4049:Zfhx4	UTSW	3	5398859	missense	probably damaging	1.00
R4073:Zfhx4	UTSW	3	5399324	missense	probably damaging	1.00
R4134:Zfhx4	UTSW	3	5243627	missense	probably damaging	1.00
R4401:Zfhx4	UTSW	3	5403345	nonsense	probably null
R4439:Zfhx4	UTSW	3	5214815	unclassified	probably benign
R4497:Zfhx4	UTSW	3	5399620	missense	possibly damaging	0.88
R4518:Zfhx4	UTSW	3	5412518	missense	probably damaging	1.00
R4569:Zfhx4	UTSW	3	5401834	missense	probably benign	0.00
R4612:Zfhx4	UTSW	3	5397063	missense	probably damaging	1.00
R4616:Zfhx4	UTSW	3	5413067	missense	possibly damaging	0.66
R4626:Zfhx4	UTSW	3	5402639	missense	probably damaging	1.00
R4628:Zfhx4	UTSW	3	5403476	missense	probably damaging	1.00
R4637:Zfhx4	UTSW	3	5403404	missense	probably damaging	1.00
R4647:Zfhx4	UTSW	3	5399281	missense	probably damaging	0.99
R4708:Zfhx4	UTSW	3	5245503	splice site	probably null
R4729:Zfhx4	UTSW	3	5399497	missense	probably damaging	1.00
R4732:Zfhx4	UTSW	3	5214807	unclassified	probably benign
R4757:Zfhx4	UTSW	3	5400062	missense	possibly damaging	0.85
R4765:Zfhx4	UTSW	3	5400152	missense	probably benign
R4819:Zfhx4	UTSW	3	5403914	missense	probably benign	0.05
R4937:Zfhx4	UTSW	3	5242011	missense	probably damaging	1.00
R4980:Zfhx4	UTSW	3	5398979	missense	possibly damaging	0.47
R5124:Zfhx4	UTSW	3	5242047	missense	probably damaging	1.00
R5214:Zfhx4	UTSW	3	5403641	missense	probably damaging	1.00
R5361:Zfhx4	UTSW	3	5399207	missense	probably damaging	0.99
R5375:Zfhx4	UTSW	3	5412425	missense	probably damaging	0.99
R5485:Zfhx4	UTSW	3	5243007	missense	probably damaging	1.00
R5588:Zfhx4	UTSW	3	5403138	missense	probably damaging	1.00
R5609:Zfhx4	UTSW	3	5403619	missense	probably damaging	1.00
R5726:Zfhx4	UTSW	3	5403321	missense	probably benign	0.02
R5758:Zfhx4	UTSW	3	5402620	missense	probably damaging	1.00
R5865:Zfhx4	UTSW	3	5402659	missense	probably damaging	1.00
R5938:Zfhx4	UTSW	3	5402138	missense	probably damaging	0.99
R5952:Zfhx4	UTSW	3	5396970	missense	probably damaging	0.99
R6043:Zfhx4	UTSW	3	5403427	missense	probably benign	0.00
R6045:Zfhx4	UTSW	3	5396959	missense	probably damaging	1.00
R6125:Zfhx4	UTSW	3	5398811	missense	possibly damaging	0.68
R6354:Zfhx4	UTSW	3	5401951	missense	probably benign
R6374:Zfhx4	UTSW	3	5244035	missense	probably damaging	1.00
R6378:Zfhx4	UTSW	3	5243350	missense	probably benign	0.07
R6380:Zfhx4	UTSW	3	5413110	missense	probably damaging	0.99
R6413:Zfhx4	UTSW	3	5243145	missense	probably damaging	1.00
R6449:Zfhx4	UTSW	3	5242428	missense	probably damaging	1.00
R6539:Zfhx4	UTSW	3	5244108	missense	probably damaging	0.99
R6714:Zfhx4	UTSW	3	5241837	missense	probably damaging	1.00
R6933:Zfhx4	UTSW	3	5412987	missense	probably damaging	0.99
R6982:Zfhx4	UTSW	3	5403830	missense	probably damaging	1.00
R7104:Zfhx4	UTSW	3	5402489	missense	probably damaging	0.97
R7127:Zfhx4	UTSW	3	5413044	missense	probably damaging	0.99
R7138:Zfhx4	UTSW	3	5412047	missense	possibly damaging	0.69
R7161:Zfhx4	UTSW	3	5244083	missense	possibly damaging	0.65
R7213:Zfhx4	UTSW	3	5396644	missense	probably benign
R7483:Zfhx4	UTSW	3	5412177	missense	probably damaging	0.98
R7514:Zfhx4	UTSW	3	5242207	missense	possibly damaging	0.91
R7544:Zfhx4	UTSW	3	5412815	missense	probably damaging	0.98
R7565:Zfhx4	UTSW	3	5390366	missense	probably benign	0.04
R7611:Zfhx4	UTSW	3	5403771	missense	probably damaging	1.00
R7640:Zfhx4	UTSW	3	5412480	missense	probably benign	0.19
R7649:Zfhx4	UTSW	3	5242110	missense	probably damaging	1.00
R7689:Zfhx4	UTSW	3	5411886	missense	probably benign	0.05
R7711:Zfhx4	UTSW	3	5396956	missense	probably damaging	0.98
R7895:Zfhx4	UTSW	3	5242199	missense	probably benign	0.00
R7920:Zfhx4	UTSW	3	5400455	missense	possibly damaging	0.62
R7972:Zfhx4	UTSW	3	5412473	missense	probably benign	0.02
R7993:Zfhx4	UTSW	3	5412987	missense	probably damaging	1.00
R8133:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R8158:Zfhx4	UTSW	3	5398950	nonsense	probably null
R8272:Zfhx4	UTSW	3	5243867	missense	probably damaging	0.99
R8285:Zfhx4	UTSW	3	5401856	missense	probably benign	0.17
R8321:Zfhx4	UTSW	3	5401127	missense	probably damaging	1.00
R8381:Zfhx4	UTSW	3	5382616	missense	probably benign	0.00
R8434:Zfhx4	UTSW	3	5398858	missense	probably damaging	0.99
R8466:Zfhx4	UTSW	3	5242702	missense	probably damaging	1.00
R8515:Zfhx4	UTSW	3	5399474	missense	probably benign	0.00
R8525:Zfhx4	UTSW	3	5399543	missense	probably damaging	1.00
R8743:Zfhx4	UTSW	3	5244024	missense	probably damaging	1.00
R8830:Zfhx4	UTSW	3	5398889	missense	probably damaging	1.00
R8839:Zfhx4	UTSW	3	5401855	missense	probably benign
R8856:Zfhx4	UTSW	3	5390424	missense	probably benign	0.45
R8900:Zfhx4	UTSW	3	5398864	missense	probably damaging	1.00
R8917:Zfhx4	UTSW	3	5399099	missense	probably damaging	1.00
R9101:Zfhx4	UTSW	3	5412138	missense	probably benign	0.10
R9126:Zfhx4	UTSW	3	5329529	missense	probably damaging	0.99
R9159:Zfhx4	UTSW	3	5399252	missense	probably damaging	0.98
R9159:Zfhx4	UTSW	3	5401157	missense	probably damaging	1.00
R9241:Zfhx4	UTSW	3	5243637	missense	probably damaging	1.00
R9295:Zfhx4	UTSW	3	5329465	missense	probably benign
R9376:Zfhx4	UTSW	3	5241773	missense	probably damaging	1.00
R9376:Zfhx4	UTSW	3	5400335	missense	probably benign	0.04
R9550:Zfhx4	UTSW	3	5399512	missense	probably damaging	1.00
R9680:Zfhx4	UTSW	3	5400596	missense	probably damaging	1.00
R9782:Zfhx4	UTSW	3	5401454	missense	probably benign	0.38
R9787:Zfhx4	UTSW	3	5390446	missense	possibly damaging	0.94
R9790:Zfhx4	UTSW	3	5399862	missense	probably damaging	1.00
R9791:Zfhx4	UTSW	3	5399862	missense	probably damaging	1.00
RF019:Zfhx4	UTSW	3	5403267	missense	probably benign	0.08
X0025:Zfhx4	UTSW	3	5411836	missense	probably damaging	0.99
X0026:Zfhx4	UTSW	3	5412338	missense	probably benign	0.00
X0028:Zfhx4	UTSW	3	5402414	missense	probably benign	0.13
X0028:Zfhx4	UTSW	3	5403267	missense	probably damaging	1.00
X0054:Zfhx4	UTSW	3	5399710	nonsense	probably null
Z1177:Zfhx4	UTSW	3	5242446	missense	probably damaging	1.00
Z1187:Zfhx4	UTSW	3	5243007	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAACACAGTATCTGCTCCTCTGC -3'
(R):5'- CCTGGATGATCTTTTGCTGAATGCG -3'

Sequencing Primer
(F):5'- cctcctcctcctcctcctc -3'
(R):5'- ATCTTTTGCTGAATGCGGCATC -3'

Posted On

2013-05-23