Mutagenetix > Incidental Mutation

Incidental Mutation 'R4962:Anks6'

381819

Institutional Source

Beutler Lab

Gene Symbol

Anks6

Ensembl Gene

ENSMUSG00000066191

Gene Name

ankyrin repeat and sterile alpha motif domain containing 6

Synonyms

b2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6

MMRRC Submission

042559-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4962 (G1)

Quality Score

197

Status

Not validated

Chromosome

Chromosomal Location

47015669-47057427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 47030795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 601 (G601S)

Ref Sequence

ENSEMBL: ENSMUSP00000081665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]

AlphaFold

Q6GQX6

Predicted Effect

probably damaging
Transcript: ENSMUST00000084616
AA Change: G601S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: G601S

Domain	Start	End	E-Value	Type
ANK	8	37	2.39e2	SMART
ANK	68	97	5.62e-4	SMART
ANK	101	130	2.05e-6	SMART
ANK	134	163	1.9e-1	SMART
ANK	181	210	8.99e-3	SMART
ANK	215	244	7.83e-3	SMART
ANK	282	312	5.87e2	SMART
ANK	316	345	1.22e-4	SMART
ANK	350	379	3.57e-6	SMART
ANK	383	414	1.23e3	SMART
low complexity region	539	575	N/A	INTRINSIC
low complexity region	619	673	N/A	INTRINSIC
SAM	700	766	2.73e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107747
AA Change: G669S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: G669S

Domain	Start	End	E-Value	Type
ANK	8	37	2.39e2	SMART
ANK	68	97	5.62e-4	SMART
ANK	101	130	2.05e-6	SMART
ANK	134	163	1.9e-1	SMART
ANK	181	210	8.99e-3	SMART
ANK	215	244	7.83e-3	SMART
ANK	282	312	5.87e2	SMART
ANK	316	345	1.22e-4	SMART
ANK	350	379	3.57e-6	SMART
ANK	383	414	1.23e3	SMART
low complexity region	607	643	N/A	INTRINSIC
low complexity region	687	741	N/A	INTRINSIC
low complexity region	748	768	N/A	INTRINSIC
Blast:SAM	769	796	1e-9	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000229609
AA Change: G669S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,472,808	F317L	possibly damaging	Het
Abcc4	A	G	14: 118,668,399	I85T	probably benign	Het
Acoxl	G	T	2: 128,075,890	C498F	probably damaging	Het
Akap13	C	T	7: 75,749,430	T2752I	probably damaging	Het
Ap2a2	T	G	7: 141,630,148	F836C	probably damaging	Het
Atp2c1	A	G	9: 105,442,950	V404A	probably benign	Het
Atp7b	G	T	8: 22,020,885	A415E	probably damaging	Het
Babam2	A	T	5: 31,785,583	I71L	possibly damaging	Het
Bean1	A	G	8: 104,216,974	T54A	probably damaging	Het
Cacna1b	T	A	2: 24,618,318	I1816F	probably damaging	Het
Cacna1b	C	T	2: 24,657,366	G1202D	probably damaging	Het
Casp8ap2	A	G	4: 32,640,554	E536G	probably damaging	Het
Cfap57	A	G	4: 118,613,065	V206A	probably benign	Het
Clca2	A	T	3: 145,077,879	D658E	probably damaging	Het
Cwc22	A	T	2: 77,896,309	S809T	probably benign	Het
Cyp2c54	C	T	19: 40,072,141	R132Q	possibly damaging	Het
Ddx20	A	T	3: 105,680,605	D386E	possibly damaging	Het
Ddx50	T	C	10: 62,642,853	T185A	probably damaging	Het
Decr1	G	A	4: 15,930,976	R119*	probably null	Het
Dennd4a	T	C	9: 64,906,003	S1415P	probably benign	Het
Dnah12	A	T	14: 26,716,700	I495L	probably benign	Het
Dnah2	G	A	11: 69,455,973	Q2596*	probably null	Het
Dnajb13	A	G	7: 100,507,500	L123S	probably benign	Het
Elavl3	G	A	9: 22,036,811	P19L	probably benign	Het
Fer1l6	T	C	15: 58,571,401	S518P	probably benign	Het
Fgd3	T	C	13: 49,266,629	S591G	probably benign	Het
Galnt18	C	A	7: 111,472,064	R566L	probably benign	Het
Galnt6	A	T	15: 100,696,574	Y525*	probably null	Het
Gm10036	A	T	18: 15,833,302	Y170F	probably benign	Het
Hacd2	A	G	16: 35,022,551	D24G	unknown	Het
Idh3a	T	C	9: 54,596,041	M128T	possibly damaging	Het
Ido1	C	T	8: 24,584,549	M359I	probably benign	Het
Ikbkb	T	C	8: 22,681,677	T185A	probably damaging	Het
Insl6	C	T	19: 29,321,619	G131D	probably damaging	Het
Irgm1	A	C	11: 48,866,332	S217R	possibly damaging	Het
Itga11	T	A	9: 62,761,568	Y702*	probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kansl2	T	C	15: 98,531,843	M103V	probably benign	Het
Kcnq2	T	C	2: 181,112,043	N258S	possibly damaging	Het
Kdm5d	A	T	Y: 940,624	D1045V	probably damaging	Het
Lats2	A	G	14: 57,699,592	L480P	probably damaging	Het
Lin28b	T	A	10: 45,420,640	K87N	possibly damaging	Het
Lpgat1	T	A	1: 191,719,570	W103R	probably damaging	Het
Lpl	G	T	8: 68,894,693	G166C	probably damaging	Het
Ly75	A	T	2: 60,352,125	Y569N	probably damaging	Het
Mcm8	A	T	2: 132,838,769	E564D	probably damaging	Het
Me2	G	T	18: 73,785,776	N411K	probably damaging	Het
Mn1	A	G	5: 111,454,786	T1297A	possibly damaging	Het
Mphosph8	T	A	14: 56,678,589	F447L	probably benign	Het
Nacad	T	A	11: 6,599,169	D1294V	probably damaging	Het
Neu3	A	T	7: 99,823,408	F41I	probably damaging	Het
Nlrp6	G	T	7: 140,923,584	L534F	probably damaging	Het
Nrap	A	G	19: 56,378,143	M338T	probably damaging	Het
Nuak1	T	C	10: 84,375,115	K370E	probably damaging	Het
Olfr1151	A	G	2: 87,857,288	T38A	probably benign	Het
Olfr1425	T	A	19: 12,074,275	D119V	probably damaging	Het
Olfr479	T	A	7: 108,055,440	C153S	probably benign	Het
Olfr805	C	T	10: 129,722,723	V274M	probably damaging	Het
P3h3	T	C	6: 124,841,773	S701G	probably benign	Het
Pdss2	T	C	10: 43,298,912	M138T	possibly damaging	Het
Piezo1	C	T	8: 122,486,481	E1848K	probably benign	Het
Prmt3	T	G	7: 49,826,809	S389A	probably benign	Het
Prrxl1	G	T	14: 32,647,144		probably benign	Het
Prune2	T	A	19: 17,122,273	F1714I	probably benign	Het
Ptgis	A	G	2: 167,225,274		probably null	Het
Ptpn20	T	C	14: 33,614,459	V85A	probably benign	Het
Rabepk	A	T	2: 34,780,657	Y264N	probably damaging	Het
Ralgapa2	A	T	2: 146,434,834	C495*	probably null	Het
Satb2	A	G	1: 56,891,168	I232T	probably benign	Het
Selenbp2	A	T	3: 94,703,549	L307F	probably damaging	Het
Sgpl1	T	G	10: 61,114,084	Y112S	probably damaging	Het
Slitrk5	T	C	14: 111,681,247	S768P	probably benign	Het
Smc3	T	A	19: 53,631,517	Y615N	probably damaging	Het
Spag17	A	G	3: 100,027,623	N715S	probably benign	Het
Spats2	A	G	15: 99,212,276	E518G	probably benign	Het
Spats2l	A	G	1: 57,885,824	H127R	possibly damaging	Het
Tenm3	T	A	8: 48,278,961	K1287*	probably null	Het
Thoc1	T	A	18: 9,962,387	S91T	probably benign	Het
Thoc6	C	T	17: 23,669,937	G166S	probably damaging	Het
Tmem107	C	A	11: 69,071,261	T42N	possibly damaging	Het
Tmprss11c	A	G	5: 86,237,710	I288T	probably damaging	Het
Tnrc18	A	G	5: 142,739,493	F1827S	unknown	Het
Trmt112	C	A	19: 6,910,198	T5N	probably damaging	Het
Trp53bp1	A	T	2: 121,270,546	M57K	probably benign	Het
Ttbk2	C	A	2: 120,745,150	Q1115H	probably damaging	Het
Ttn	A	G	2: 76,944,109	M2151T	probably damaging	Het
Ttn	C	A	2: 76,729,645	E27725*	probably null	Het
Usp9y	A	T	Y: 1,384,336	D727E	probably damaging	Het
Vps13c	A	G	9: 67,873,891	T221A	probably damaging	Het
Zbtb20	A	G	16: 43,618,692	D725G	probably damaging	Het
Zfp341	A	T	2: 154,626,814	I126F	possibly damaging	Het
Zfyve16	C	T	13: 92,513,894	A861T	probably damaging	Het

Other mutations in Anks6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Anks6	APN	4	47046054	missense	probably damaging	0.98
IGL01886:Anks6	APN	4	47044850	missense	probably damaging	1.00
IGL02903:Anks6	APN	4	47045004	missense	probably damaging	1.00
PIT4131001:Anks6	UTSW	4	47027109	missense	probably damaging	1.00
R0632:Anks6	UTSW	4	47033167	missense	possibly damaging	0.95
R1220:Anks6	UTSW	4	47025767	splice site	probably benign
R1398:Anks6	UTSW	4	47044926	missense	possibly damaging	0.75
R1479:Anks6	UTSW	4	47044874	missense	probably damaging	1.00
R1519:Anks6	UTSW	4	47027152	missense	probably damaging	0.99
R1713:Anks6	UTSW	4	47039726	missense	probably benign	0.00
R1781:Anks6	UTSW	4	47043639	missense	possibly damaging	0.87
R1853:Anks6	UTSW	4	47049387	missense	probably benign	0.00
R2364:Anks6	UTSW	4	47027248	missense	possibly damaging	0.93
R3790:Anks6	UTSW	4	47049212	missense	probably damaging	0.97
R4432:Anks6	UTSW	4	47044905	nonsense	probably null
R4700:Anks6	UTSW	4	47033127	missense	possibly damaging	0.86
R4847:Anks6	UTSW	4	47033266	missense	probably benign
R4876:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4877:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4878:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4879:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4961:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4968:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4970:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4971:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5092:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5113:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5389:Anks6	UTSW	4	47038900	splice site	probably benign
R5569:Anks6	UTSW	4	47045007	missense	probably damaging	1.00
R5857:Anks6	UTSW	4	47039736	missense	possibly damaging	0.92
R5977:Anks6	UTSW	4	47035748	missense	probably benign	0.11
R5978:Anks6	UTSW	4	47049252	missense	probably damaging	1.00
R6933:Anks6	UTSW	4	47049164	missense	probably benign	0.25
R7175:Anks6	UTSW	4	47046268	splice site	probably null
R7454:Anks6	UTSW	4	47038919	missense	unknown
R7874:Anks6	UTSW	4	47049275	missense	unknown
R8146:Anks6	UTSW	4	47043605	missense	unknown
R8437:Anks6	UTSW	4	47030705	missense	probably benign	0.00
R9454:Anks6	UTSW	4	47016789	missense	possibly damaging	0.86
R9462:Anks6	UTSW	4	47033142	missense	unknown
R9567:Anks6	UTSW	4	47044880	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAAGCACTGTACAGGTGTCAC -3'
(R):5'- GTGAAGACAAGCCAGCTCTTG -3'

Sequencing Primer
(F):5'- ACTGTACAGGTGTCACAGGCATC -3'
(R):5'- AAGCCAGCTCTTGCCTGC -3'

Posted On

2016-04-27