Mutagenetix > Incidental Mutation

Incidental Mutation 'R4962:Cfap57'

381820

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

042559-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4962 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118613065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 206 (V206A)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably benign
Transcript: ENSMUST00000071972
AA Change: V206A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: V206A

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921
AA Change: V206A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: V206A

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,472,808	F317L	possibly damaging	Het
Abcc4	A	G	14: 118,668,399	I85T	probably benign	Het
Acoxl	G	T	2: 128,075,890	C498F	probably damaging	Het
Akap13	C	T	7: 75,749,430	T2752I	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ap2a2	T	G	7: 141,630,148	F836C	probably damaging	Het
Atp2c1	A	G	9: 105,442,950	V404A	probably benign	Het
Atp7b	G	T	8: 22,020,885	A415E	probably damaging	Het
Babam2	A	T	5: 31,785,583	I71L	possibly damaging	Het
Bean1	A	G	8: 104,216,974	T54A	probably damaging	Het
Cacna1b	T	A	2: 24,618,318	I1816F	probably damaging	Het
Cacna1b	C	T	2: 24,657,366	G1202D	probably damaging	Het
Casp8ap2	A	G	4: 32,640,554	E536G	probably damaging	Het
Clca2	A	T	3: 145,077,879	D658E	probably damaging	Het
Cwc22	A	T	2: 77,896,309	S809T	probably benign	Het
Cyp2c54	C	T	19: 40,072,141	R132Q	possibly damaging	Het
Ddx20	A	T	3: 105,680,605	D386E	possibly damaging	Het
Ddx50	T	C	10: 62,642,853	T185A	probably damaging	Het
Decr1	G	A	4: 15,930,976	R119*	probably null	Het
Dennd4a	T	C	9: 64,906,003	S1415P	probably benign	Het
Dnah12	A	T	14: 26,716,700	I495L	probably benign	Het
Dnah2	G	A	11: 69,455,973	Q2596*	probably null	Het
Dnajb13	A	G	7: 100,507,500	L123S	probably benign	Het
Elavl3	G	A	9: 22,036,811	P19L	probably benign	Het
Fer1l6	T	C	15: 58,571,401	S518P	probably benign	Het
Fgd3	T	C	13: 49,266,629	S591G	probably benign	Het
Galnt18	C	A	7: 111,472,064	R566L	probably benign	Het
Galnt6	A	T	15: 100,696,574	Y525*	probably null	Het
Gm10036	A	T	18: 15,833,302	Y170F	probably benign	Het
Hacd2	A	G	16: 35,022,551	D24G	unknown	Het
Idh3a	T	C	9: 54,596,041	M128T	possibly damaging	Het
Ido1	C	T	8: 24,584,549	M359I	probably benign	Het
Ikbkb	T	C	8: 22,681,677	T185A	probably damaging	Het
Insl6	C	T	19: 29,321,619	G131D	probably damaging	Het
Irgm1	A	C	11: 48,866,332	S217R	possibly damaging	Het
Itga11	T	A	9: 62,761,568	Y702*	probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kansl2	T	C	15: 98,531,843	M103V	probably benign	Het
Kcnq2	T	C	2: 181,112,043	N258S	possibly damaging	Het
Kdm5d	A	T	Y: 940,624	D1045V	probably damaging	Het
Lats2	A	G	14: 57,699,592	L480P	probably damaging	Het
Lin28b	T	A	10: 45,420,640	K87N	possibly damaging	Het
Lpgat1	T	A	1: 191,719,570	W103R	probably damaging	Het
Lpl	G	T	8: 68,894,693	G166C	probably damaging	Het
Ly75	A	T	2: 60,352,125	Y569N	probably damaging	Het
Mcm8	A	T	2: 132,838,769	E564D	probably damaging	Het
Me2	G	T	18: 73,785,776	N411K	probably damaging	Het
Mn1	A	G	5: 111,454,786	T1297A	possibly damaging	Het
Mphosph8	T	A	14: 56,678,589	F447L	probably benign	Het
Nacad	T	A	11: 6,599,169	D1294V	probably damaging	Het
Neu3	A	T	7: 99,823,408	F41I	probably damaging	Het
Nlrp6	G	T	7: 140,923,584	L534F	probably damaging	Het
Nrap	A	G	19: 56,378,143	M338T	probably damaging	Het
Nuak1	T	C	10: 84,375,115	K370E	probably damaging	Het
Olfr1151	A	G	2: 87,857,288	T38A	probably benign	Het
Olfr1425	T	A	19: 12,074,275	D119V	probably damaging	Het
Olfr479	T	A	7: 108,055,440	C153S	probably benign	Het
Olfr805	C	T	10: 129,722,723	V274M	probably damaging	Het
P3h3	T	C	6: 124,841,773	S701G	probably benign	Het
Pdss2	T	C	10: 43,298,912	M138T	possibly damaging	Het
Piezo1	C	T	8: 122,486,481	E1848K	probably benign	Het
Prmt3	T	G	7: 49,826,809	S389A	probably benign	Het
Prrxl1	G	T	14: 32,647,144		probably benign	Het
Prune2	T	A	19: 17,122,273	F1714I	probably benign	Het
Ptgis	A	G	2: 167,225,274		probably null	Het
Ptpn20	T	C	14: 33,614,459	V85A	probably benign	Het
Rabepk	A	T	2: 34,780,657	Y264N	probably damaging	Het
Ralgapa2	A	T	2: 146,434,834	C495*	probably null	Het
Satb2	A	G	1: 56,891,168	I232T	probably benign	Het
Selenbp2	A	T	3: 94,703,549	L307F	probably damaging	Het
Sgpl1	T	G	10: 61,114,084	Y112S	probably damaging	Het
Slitrk5	T	C	14: 111,681,247	S768P	probably benign	Het
Smc3	T	A	19: 53,631,517	Y615N	probably damaging	Het
Spag17	A	G	3: 100,027,623	N715S	probably benign	Het
Spats2	A	G	15: 99,212,276	E518G	probably benign	Het
Spats2l	A	G	1: 57,885,824	H127R	possibly damaging	Het
Tenm3	T	A	8: 48,278,961	K1287*	probably null	Het
Thoc1	T	A	18: 9,962,387	S91T	probably benign	Het
Thoc6	C	T	17: 23,669,937	G166S	probably damaging	Het
Tmem107	C	A	11: 69,071,261	T42N	possibly damaging	Het
Tmprss11c	A	G	5: 86,237,710	I288T	probably damaging	Het
Tnrc18	A	G	5: 142,739,493	F1827S	unknown	Het
Trmt112	C	A	19: 6,910,198	T5N	probably damaging	Het
Trp53bp1	A	T	2: 121,270,546	M57K	probably benign	Het
Ttbk2	C	A	2: 120,745,150	Q1115H	probably damaging	Het
Ttn	A	G	2: 76,944,109	M2151T	probably damaging	Het
Ttn	C	A	2: 76,729,645	E27725*	probably null	Het
Usp9y	A	T	Y: 1,384,336	D727E	probably damaging	Het
Vps13c	A	G	9: 67,873,891	T221A	probably damaging	Het
Zbtb20	A	G	16: 43,618,692	D725G	probably damaging	Het
Zfp341	A	T	2: 154,626,814	I126F	possibly damaging	Het
Zfyve16	C	T	13: 92,513,894	A861T	probably damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACTTTGGCAGTGCAATGC -3'
(R):5'- AAGCAGGAAGATTCATCGTATTCAC -3'

Sequencing Primer
(F):5'- CAGTGCAATGCAGGCATG -3'
(R):5'- AGCATCAGTTCCCAGGAT -3'

Posted On

2016-04-27