Incidental Mutation 'R4962:Nlrp6'
ID 381835
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene Name NLR family, pyrin domain containing 6
Synonyms Nalp6
MMRRC Submission 042559-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4962 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140500815-140509105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 140503497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 534 (L534F)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
AlphaFold Q91WS2
Predicted Effect probably benign
Transcript: ENSMUST00000106045
AA Change: L504F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: L504F

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably benign
Transcript: ENSMUST00000183845
AA Change: L504F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: L504F

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000184560
AA Change: L534F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: L534F

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,314,728 (GRCm39) F317L possibly damaging Het
Abcc4 A G 14: 118,905,811 (GRCm39) I85T probably benign Het
Acoxl G T 2: 127,917,810 (GRCm39) C498F probably damaging Het
Akap13 C T 7: 75,399,178 (GRCm39) T2752I probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ap2a2 T G 7: 141,210,061 (GRCm39) F836C probably damaging Het
Atp2c1 A G 9: 105,320,149 (GRCm39) V404A probably benign Het
Atp7b G T 8: 22,510,901 (GRCm39) A415E probably damaging Het
Babam2 A T 5: 31,942,927 (GRCm39) I71L possibly damaging Het
Bean1 A G 8: 104,943,606 (GRCm39) T54A probably damaging Het
Cacna1b T A 2: 24,508,330 (GRCm39) I1816F probably damaging Het
Cacna1b C T 2: 24,547,378 (GRCm39) G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 (GRCm39) E536G probably damaging Het
Cfap57 A G 4: 118,470,262 (GRCm39) V206A probably benign Het
Clca3a2 A T 3: 144,783,640 (GRCm39) D658E probably damaging Het
Cwc22 A T 2: 77,726,653 (GRCm39) S809T probably benign Het
Cyp2c54 C T 19: 40,060,585 (GRCm39) R132Q possibly damaging Het
Ddx20 A T 3: 105,587,921 (GRCm39) D386E possibly damaging Het
Ddx50 T C 10: 62,478,632 (GRCm39) T185A probably damaging Het
Decr1 G A 4: 15,930,976 (GRCm39) R119* probably null Het
Dennd4a T C 9: 64,813,285 (GRCm39) S1415P probably benign Het
Dnah12 A T 14: 26,437,855 (GRCm39) I495L probably benign Het
Dnah2 G A 11: 69,346,799 (GRCm39) Q2596* probably null Het
Dnajb13 A G 7: 100,156,707 (GRCm39) L123S probably benign Het
Drgx G T 14: 32,369,101 (GRCm39) probably benign Het
Elavl3 G A 9: 21,948,107 (GRCm39) P19L probably benign Het
Fer1l6 T C 15: 58,443,250 (GRCm39) S518P probably benign Het
Fgd3 T C 13: 49,420,105 (GRCm39) S591G probably benign Het
Galnt18 C A 7: 111,071,271 (GRCm39) R566L probably benign Het
Galnt6 A T 15: 100,594,455 (GRCm39) Y525* probably null Het
Gm10036 A T 18: 15,966,359 (GRCm39) Y170F probably benign Het
Hacd2 A G 16: 34,842,921 (GRCm39) D24G unknown Het
Idh3a T C 9: 54,503,325 (GRCm39) M128T possibly damaging Het
Ido1 C T 8: 25,074,565 (GRCm39) M359I probably benign Het
Ikbkb T C 8: 23,171,693 (GRCm39) T185A probably damaging Het
Insl6 C T 19: 29,299,019 (GRCm39) G131D probably damaging Het
Irgm1 A C 11: 48,757,159 (GRCm39) S217R possibly damaging Het
Itga11 T A 9: 62,668,850 (GRCm39) Y702* probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kansl2 T C 15: 98,429,724 (GRCm39) M103V probably benign Het
Kcnq2 T C 2: 180,753,836 (GRCm39) N258S possibly damaging Het
Kdm5d A T Y: 940,624 (GRCm39) D1045V probably damaging Het
Lats2 A G 14: 57,937,049 (GRCm39) L480P probably damaging Het
Lin28b T A 10: 45,296,736 (GRCm39) K87N possibly damaging Het
Lpgat1 T A 1: 191,451,682 (GRCm39) W103R probably damaging Het
Lpl G T 8: 69,347,345 (GRCm39) G166C probably damaging Het
Ly75 A T 2: 60,182,469 (GRCm39) Y569N probably damaging Het
Mcm8 A T 2: 132,680,689 (GRCm39) E564D probably damaging Het
Me2 G T 18: 73,918,847 (GRCm39) N411K probably damaging Het
Mn1 A G 5: 111,602,652 (GRCm39) T1297A possibly damaging Het
Mphosph8 T A 14: 56,916,046 (GRCm39) F447L probably benign Het
Nacad T A 11: 6,549,169 (GRCm39) D1294V probably damaging Het
Neu3 A T 7: 99,472,615 (GRCm39) F41I probably damaging Het
Nrap A G 19: 56,366,575 (GRCm39) M338T probably damaging Het
Nuak1 T C 10: 84,210,979 (GRCm39) K370E probably damaging Het
Or10ab4 T A 7: 107,654,647 (GRCm39) C153S probably benign Het
Or4d10 T A 19: 12,051,639 (GRCm39) D119V probably damaging Het
Or5w8 A G 2: 87,687,632 (GRCm39) T38A probably benign Het
Or6c212 C T 10: 129,558,592 (GRCm39) V274M probably damaging Het
P3h3 T C 6: 124,818,736 (GRCm39) S701G probably benign Het
Pdss2 T C 10: 43,174,908 (GRCm39) M138T possibly damaging Het
Piezo1 C T 8: 123,213,220 (GRCm39) E1848K probably benign Het
Prmt3 T G 7: 49,476,557 (GRCm39) S389A probably benign Het
Prune2 T A 19: 17,099,637 (GRCm39) F1714I probably benign Het
Ptgis A G 2: 167,067,194 (GRCm39) probably null Het
Ptpn20 T C 14: 33,336,416 (GRCm39) V85A probably benign Het
Rabepk A T 2: 34,670,669 (GRCm39) Y264N probably damaging Het
Ralgapa2 A T 2: 146,276,754 (GRCm39) C495* probably null Het
Satb2 A G 1: 56,930,327 (GRCm39) I232T probably benign Het
Selenbp2 A T 3: 94,610,856 (GRCm39) L307F probably damaging Het
Sgpl1 T G 10: 60,949,863 (GRCm39) Y112S probably damaging Het
Slitrk5 T C 14: 111,918,679 (GRCm39) S768P probably benign Het
Smc3 T A 19: 53,619,948 (GRCm39) Y615N probably damaging Het
Spag17 A G 3: 99,934,939 (GRCm39) N715S probably benign Het
Spats2 A G 15: 99,110,157 (GRCm39) E518G probably benign Het
Spats2l A G 1: 57,924,983 (GRCm39) H127R possibly damaging Het
Tenm3 T A 8: 48,731,996 (GRCm39) K1287* probably null Het
Thoc1 T A 18: 9,962,387 (GRCm39) S91T probably benign Het
Thoc6 C T 17: 23,888,911 (GRCm39) G166S probably damaging Het
Tmem107 C A 11: 68,962,087 (GRCm39) T42N possibly damaging Het
Tmprss11c A G 5: 86,385,569 (GRCm39) I288T probably damaging Het
Tnrc18 A G 5: 142,725,248 (GRCm39) F1827S unknown Het
Trmt112 C A 19: 6,887,566 (GRCm39) T5N probably damaging Het
Trp53bp1 A T 2: 121,101,027 (GRCm39) M57K probably benign Het
Ttbk2 C A 2: 120,575,631 (GRCm39) Q1115H probably damaging Het
Ttn C A 2: 76,559,989 (GRCm39) E27725* probably null Het
Ttn A G 2: 76,774,453 (GRCm39) M2151T probably damaging Het
Usp9y A T Y: 1,384,336 (GRCm39) D727E probably damaging Het
Vps13c A G 9: 67,781,173 (GRCm39) T221A probably damaging Het
Zbtb20 A G 16: 43,439,055 (GRCm39) D725G probably damaging Het
Zfp341 A T 2: 154,468,734 (GRCm39) I126F possibly damaging Het
Zfyve16 C T 13: 92,650,402 (GRCm39) A861T probably damaging Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140,503,037 (GRCm39) missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140,501,709 (GRCm39) missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140,505,103 (GRCm39) missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140,503,413 (GRCm39) missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140,502,348 (GRCm39) missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140,503,333 (GRCm39) missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140,507,400 (GRCm39) missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140,503,399 (GRCm39) nonsense probably null
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1404:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R1472:Nlrp6 UTSW 7 140,503,408 (GRCm39) missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140,502,959 (GRCm39) missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140,503,006 (GRCm39) missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140,504,026 (GRCm39) small deletion probably benign
R2097:Nlrp6 UTSW 7 140,503,117 (GRCm39) missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140,506,357 (GRCm39) missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140,502,076 (GRCm39) missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140,506,682 (GRCm39) missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140,501,568 (GRCm39) missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140,501,694 (GRCm39) missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140,504,006 (GRCm39) missense probably damaging 1.00
R5436:Nlrp6 UTSW 7 140,502,630 (GRCm39) nonsense probably null
R5442:Nlrp6 UTSW 7 140,502,103 (GRCm39) missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140,503,403 (GRCm39) missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140,502,725 (GRCm39) nonsense probably null
R6124:Nlrp6 UTSW 7 140,503,160 (GRCm39) missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140,507,422 (GRCm39) missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140,507,356 (GRCm39) missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140,503,433 (GRCm39) missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140,502,780 (GRCm39) missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140,501,191 (GRCm39) start gained probably benign
R7532:Nlrp6 UTSW 7 140,505,097 (GRCm39) missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140,507,353 (GRCm39) missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140,503,168 (GRCm39) missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140,503,754 (GRCm39) missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140,502,743 (GRCm39) missense possibly damaging 0.83
R9114:Nlrp6 UTSW 7 140,506,332 (GRCm39) missense probably damaging 1.00
V7732:Nlrp6 UTSW 7 140,506,561 (GRCm39) splice site probably benign
Z1176:Nlrp6 UTSW 7 140,502,634 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGAGAACGCTGTGTC -3'
(R):5'- TTTCACATGATCTGGCACCACAC -3'

Sequencing Primer
(F):5'- AGAACGCTGTGTCGCCTG -3'
(R):5'- CAGCCAAAATGGTTTCCAATGTC -3'
Posted On 2016-04-27