Incidental Mutation 'R4962:Tenm3'
ID381841
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 042559-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R4962 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 48278961 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1287 (K1287*)
Ref Sequence ENSEMBL: ENSMUSP00000140141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
Predicted Effect probably null
Transcript: ENSMUST00000033965
AA Change: K1303*
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: K1303*

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129821
AA Change: K941*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145344
Predicted Effect probably null
Transcript: ENSMUST00000190840
AA Change: K1287*
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: K1287*

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,808 F317L possibly damaging Het
Abcc4 A G 14: 118,668,399 I85T probably benign Het
Acoxl G T 2: 128,075,890 C498F probably damaging Het
Akap13 C T 7: 75,749,430 T2752I probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ap2a2 T G 7: 141,630,148 F836C probably damaging Het
Atp2c1 A G 9: 105,442,950 V404A probably benign Het
Atp7b G T 8: 22,020,885 A415E probably damaging Het
Babam2 A T 5: 31,785,583 I71L possibly damaging Het
Bean1 A G 8: 104,216,974 T54A probably damaging Het
Cacna1b T A 2: 24,618,318 I1816F probably damaging Het
Cacna1b C T 2: 24,657,366 G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 E536G probably damaging Het
Cfap57 A G 4: 118,613,065 V206A probably benign Het
Clca2 A T 3: 145,077,879 D658E probably damaging Het
Cwc22 A T 2: 77,896,309 S809T probably benign Het
Cyp2c54 C T 19: 40,072,141 R132Q possibly damaging Het
Ddx20 A T 3: 105,680,605 D386E possibly damaging Het
Ddx50 T C 10: 62,642,853 T185A probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dennd4a T C 9: 64,906,003 S1415P probably benign Het
Dnah12 A T 14: 26,716,700 I495L probably benign Het
Dnah2 G A 11: 69,455,973 Q2596* probably null Het
Dnajb13 A G 7: 100,507,500 L123S probably benign Het
Elavl3 G A 9: 22,036,811 P19L probably benign Het
Fer1l6 T C 15: 58,571,401 S518P probably benign Het
Fgd3 T C 13: 49,266,629 S591G probably benign Het
Galnt18 C A 7: 111,472,064 R566L probably benign Het
Galnt6 A T 15: 100,696,574 Y525* probably null Het
Gm10036 A T 18: 15,833,302 Y170F probably benign Het
Hacd2 A G 16: 35,022,551 D24G unknown Het
Idh3a T C 9: 54,596,041 M128T possibly damaging Het
Ido1 C T 8: 24,584,549 M359I probably benign Het
Ikbkb T C 8: 22,681,677 T185A probably damaging Het
Insl6 C T 19: 29,321,619 G131D probably damaging Het
Irgm1 A C 11: 48,866,332 S217R possibly damaging Het
Itga11 T A 9: 62,761,568 Y702* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl2 T C 15: 98,531,843 M103V probably benign Het
Kcnq2 T C 2: 181,112,043 N258S possibly damaging Het
Kdm5d A T Y: 940,624 D1045V probably damaging Het
Lats2 A G 14: 57,699,592 L480P probably damaging Het
Lin28b T A 10: 45,420,640 K87N possibly damaging Het
Lpgat1 T A 1: 191,719,570 W103R probably damaging Het
Lpl G T 8: 68,894,693 G166C probably damaging Het
Ly75 A T 2: 60,352,125 Y569N probably damaging Het
Mcm8 A T 2: 132,838,769 E564D probably damaging Het
Me2 G T 18: 73,785,776 N411K probably damaging Het
Mn1 A G 5: 111,454,786 T1297A possibly damaging Het
Mphosph8 T A 14: 56,678,589 F447L probably benign Het
Nacad T A 11: 6,599,169 D1294V probably damaging Het
Neu3 A T 7: 99,823,408 F41I probably damaging Het
Nlrp6 G T 7: 140,923,584 L534F probably damaging Het
Nrap A G 19: 56,378,143 M338T probably damaging Het
Nuak1 T C 10: 84,375,115 K370E probably damaging Het
Olfr1151 A G 2: 87,857,288 T38A probably benign Het
Olfr1425 T A 19: 12,074,275 D119V probably damaging Het
Olfr479 T A 7: 108,055,440 C153S probably benign Het
Olfr805 C T 10: 129,722,723 V274M probably damaging Het
P3h3 T C 6: 124,841,773 S701G probably benign Het
Pdss2 T C 10: 43,298,912 M138T possibly damaging Het
Piezo1 C T 8: 122,486,481 E1848K probably benign Het
Prmt3 T G 7: 49,826,809 S389A probably benign Het
Prrxl1 G T 14: 32,647,144 probably benign Het
Prune2 T A 19: 17,122,273 F1714I probably benign Het
Ptgis A G 2: 167,225,274 probably null Het
Ptpn20 T C 14: 33,614,459 V85A probably benign Het
Rabepk A T 2: 34,780,657 Y264N probably damaging Het
Ralgapa2 A T 2: 146,434,834 C495* probably null Het
Satb2 A G 1: 56,891,168 I232T probably benign Het
Selenbp2 A T 3: 94,703,549 L307F probably damaging Het
Sgpl1 T G 10: 61,114,084 Y112S probably damaging Het
Slitrk5 T C 14: 111,681,247 S768P probably benign Het
Smc3 T A 19: 53,631,517 Y615N probably damaging Het
Spag17 A G 3: 100,027,623 N715S probably benign Het
Spats2 A G 15: 99,212,276 E518G probably benign Het
Spats2l A G 1: 57,885,824 H127R possibly damaging Het
Thoc1 T A 18: 9,962,387 S91T probably benign Het
Thoc6 C T 17: 23,669,937 G166S probably damaging Het
Tmem107 C A 11: 69,071,261 T42N possibly damaging Het
Tmprss11c A G 5: 86,237,710 I288T probably damaging Het
Tnrc18 A G 5: 142,739,493 F1827S unknown Het
Trmt112 C A 19: 6,910,198 T5N probably damaging Het
Trp53bp1 A T 2: 121,270,546 M57K probably benign Het
Ttbk2 C A 2: 120,745,150 Q1115H probably damaging Het
Ttn C A 2: 76,729,645 E27725* probably null Het
Ttn A G 2: 76,944,109 M2151T probably damaging Het
Usp9y A T Y: 1,384,336 D727E probably damaging Het
Vps13c A G 9: 67,873,891 T221A probably damaging Het
Zbtb20 A G 16: 43,618,692 D725G probably damaging Het
Zfp341 A T 2: 154,626,814 I126F possibly damaging Het
Zfyve16 C T 13: 92,513,894 A861T probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7926:Tenm3 UTSW 8 48229111 nonsense probably null
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTAGATGTGATGCAGCTTTC -3'
(R):5'- TTTACAGTAGCAACCCAGCTC -3'

Sequencing Primer
(F):5'- TGTGATGCAGCTTTCAAGAACACG -3'
(R):5'- CAGTCACCGGAGATTTGTACGTC -3'
Posted On2016-04-27