Incidental Mutation 'R4962:Lpl'
ID381842
Institutional Source Beutler Lab
Gene Symbol Lpl
Ensembl Gene ENSMUSG00000015568
Gene Namelipoprotein lipase
SynonymsO 1-4-5
MMRRC Submission 042559-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4962 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location68880491-68907448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 68894693 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 166 (G166C)
Ref Sequence ENSEMBL: ENSMUSP00000132259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015712] [ENSMUST00000168401]
Predicted Effect probably damaging
Transcript: ENSMUST00000015712
AA Change: G166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015712
Gene: ENSMUSG00000015568
AA Change: G166C

DomainStartEndE-ValueType
Pfam:Lipase 19 338 7.8e-133 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168401
AA Change: G166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132259
Gene: ENSMUSG00000015568
AA Change: G166C

DomainStartEndE-ValueType
Pfam:Lipase 19 338 1.1e-117 PFAM
Pfam:Abhydrolase_6 76 264 3e-10 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169749
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LPL encodes lipoprotein lipase, which is expressed in heart, muscle, and adipose tissue. LPL functions as a homodimer, and has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. Severe mutations that cause LPL deficiency result in type I hyperlipoproteinemia, while less extreme mutations in LPL are linked to many disorders of lipoprotein metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations become cyanotic and die within 2 days of birth due to chylomicron engorgement of capillaries. Mutants show hypertriglyceridemia and reduced fat stores. Heterozygotes show 1.5-2-fold elevated triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,808 F317L possibly damaging Het
Abcc4 A G 14: 118,668,399 I85T probably benign Het
Acoxl G T 2: 128,075,890 C498F probably damaging Het
Akap13 C T 7: 75,749,430 T2752I probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ap2a2 T G 7: 141,630,148 F836C probably damaging Het
Atp2c1 A G 9: 105,442,950 V404A probably benign Het
Atp7b G T 8: 22,020,885 A415E probably damaging Het
Babam2 A T 5: 31,785,583 I71L possibly damaging Het
Bean1 A G 8: 104,216,974 T54A probably damaging Het
Cacna1b T A 2: 24,618,318 I1816F probably damaging Het
Cacna1b C T 2: 24,657,366 G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 E536G probably damaging Het
Cfap57 A G 4: 118,613,065 V206A probably benign Het
Clca2 A T 3: 145,077,879 D658E probably damaging Het
Cwc22 A T 2: 77,896,309 S809T probably benign Het
Cyp2c54 C T 19: 40,072,141 R132Q possibly damaging Het
Ddx20 A T 3: 105,680,605 D386E possibly damaging Het
Ddx50 T C 10: 62,642,853 T185A probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dennd4a T C 9: 64,906,003 S1415P probably benign Het
Dnah12 A T 14: 26,716,700 I495L probably benign Het
Dnah2 G A 11: 69,455,973 Q2596* probably null Het
Dnajb13 A G 7: 100,507,500 L123S probably benign Het
Elavl3 G A 9: 22,036,811 P19L probably benign Het
Fer1l6 T C 15: 58,571,401 S518P probably benign Het
Fgd3 T C 13: 49,266,629 S591G probably benign Het
Galnt18 C A 7: 111,472,064 R566L probably benign Het
Galnt6 A T 15: 100,696,574 Y525* probably null Het
Gm10036 A T 18: 15,833,302 Y170F probably benign Het
Hacd2 A G 16: 35,022,551 D24G unknown Het
Idh3a T C 9: 54,596,041 M128T possibly damaging Het
Ido1 C T 8: 24,584,549 M359I probably benign Het
Ikbkb T C 8: 22,681,677 T185A probably damaging Het
Insl6 C T 19: 29,321,619 G131D probably damaging Het
Irgm1 A C 11: 48,866,332 S217R possibly damaging Het
Itga11 T A 9: 62,761,568 Y702* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl2 T C 15: 98,531,843 M103V probably benign Het
Kcnq2 T C 2: 181,112,043 N258S possibly damaging Het
Kdm5d A T Y: 940,624 D1045V probably damaging Het
Lats2 A G 14: 57,699,592 L480P probably damaging Het
Lin28b T A 10: 45,420,640 K87N possibly damaging Het
Lpgat1 T A 1: 191,719,570 W103R probably damaging Het
Ly75 A T 2: 60,352,125 Y569N probably damaging Het
Mcm8 A T 2: 132,838,769 E564D probably damaging Het
Me2 G T 18: 73,785,776 N411K probably damaging Het
Mn1 A G 5: 111,454,786 T1297A possibly damaging Het
Mphosph8 T A 14: 56,678,589 F447L probably benign Het
Nacad T A 11: 6,599,169 D1294V probably damaging Het
Neu3 A T 7: 99,823,408 F41I probably damaging Het
Nlrp6 G T 7: 140,923,584 L534F probably damaging Het
Nrap A G 19: 56,378,143 M338T probably damaging Het
Nuak1 T C 10: 84,375,115 K370E probably damaging Het
Olfr1151 A G 2: 87,857,288 T38A probably benign Het
Olfr1425 T A 19: 12,074,275 D119V probably damaging Het
Olfr479 T A 7: 108,055,440 C153S probably benign Het
Olfr805 C T 10: 129,722,723 V274M probably damaging Het
P3h3 T C 6: 124,841,773 S701G probably benign Het
Pdss2 T C 10: 43,298,912 M138T possibly damaging Het
Piezo1 C T 8: 122,486,481 E1848K probably benign Het
Prmt3 T G 7: 49,826,809 S389A probably benign Het
Prrxl1 G T 14: 32,647,144 probably benign Het
Prune2 T A 19: 17,122,273 F1714I probably benign Het
Ptgis A G 2: 167,225,274 probably null Het
Ptpn20 T C 14: 33,614,459 V85A probably benign Het
Rabepk A T 2: 34,780,657 Y264N probably damaging Het
Ralgapa2 A T 2: 146,434,834 C495* probably null Het
Satb2 A G 1: 56,891,168 I232T probably benign Het
Selenbp2 A T 3: 94,703,549 L307F probably damaging Het
Sgpl1 T G 10: 61,114,084 Y112S probably damaging Het
Slitrk5 T C 14: 111,681,247 S768P probably benign Het
Smc3 T A 19: 53,631,517 Y615N probably damaging Het
Spag17 A G 3: 100,027,623 N715S probably benign Het
Spats2 A G 15: 99,212,276 E518G probably benign Het
Spats2l A G 1: 57,885,824 H127R possibly damaging Het
Tenm3 T A 8: 48,278,961 K1287* probably null Het
Thoc1 T A 18: 9,962,387 S91T probably benign Het
Thoc6 C T 17: 23,669,937 G166S probably damaging Het
Tmem107 C A 11: 69,071,261 T42N possibly damaging Het
Tmprss11c A G 5: 86,237,710 I288T probably damaging Het
Tnrc18 A G 5: 142,739,493 F1827S unknown Het
Trmt112 C A 19: 6,910,198 T5N probably damaging Het
Trp53bp1 A T 2: 121,270,546 M57K probably benign Het
Ttbk2 C A 2: 120,745,150 Q1115H probably damaging Het
Ttn C A 2: 76,729,645 E27725* probably null Het
Ttn A G 2: 76,944,109 M2151T probably damaging Het
Usp9y A T Y: 1,384,336 D727E probably damaging Het
Vps13c A G 9: 67,873,891 T221A probably damaging Het
Zbtb20 A G 16: 43,618,692 D725G probably damaging Het
Zfp341 A T 2: 154,626,814 I126F possibly damaging Het
Zfyve16 C T 13: 92,513,894 A861T probably damaging Het
Other mutations in Lpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Lpl APN 8 68902366 missense probably benign 0.00
IGL01161:Lpl APN 8 68892625 nonsense probably null
IGL01370:Lpl APN 8 68887568 missense possibly damaging 0.92
IGL01420:Lpl APN 8 68887433 splice site probably benign
IGL02034:Lpl APN 8 68880772 missense possibly damaging 0.64
IGL02227:Lpl APN 8 68895800 missense probably damaging 0.99
IGL02949:Lpl APN 8 68892748 missense probably damaging 1.00
IGL03237:Lpl APN 8 68894726 missense possibly damaging 0.90
Bensadoun UTSW 8 68896807 missense probably benign 0.03
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0490:Lpl UTSW 8 68896691 missense probably damaging 0.98
R1252:Lpl UTSW 8 68892659 missense probably benign 0.03
R1331:Lpl UTSW 8 68896629 missense probably damaging 0.99
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1444:Lpl UTSW 8 68892747 missense probably damaging 0.99
R1722:Lpl UTSW 8 68896602 frame shift probably null
R1826:Lpl UTSW 8 68902291 missense possibly damaging 0.62
R1867:Lpl UTSW 8 68896602 frame shift probably null
R1874:Lpl UTSW 8 68896619 missense probably damaging 1.00
R1970:Lpl UTSW 8 68896802 nonsense probably null
R2401:Lpl UTSW 8 68901243 missense possibly damaging 0.52
R2516:Lpl UTSW 8 68887518 missense probably benign 0.00
R2850:Lpl UTSW 8 68899512 nonsense probably null
R4688:Lpl UTSW 8 68899425 missense probably damaging 1.00
R4773:Lpl UTSW 8 68896751 missense probably damaging 1.00
R4993:Lpl UTSW 8 68895793 missense probably benign 0.23
R5343:Lpl UTSW 8 68895737 missense probably damaging 1.00
R6018:Lpl UTSW 8 68901288 missense probably benign
R6082:Lpl UTSW 8 68896649 missense probably damaging 0.98
R6137:Lpl UTSW 8 68892747 missense probably damaging 0.99
R6589:Lpl UTSW 8 68896807 missense probably benign 0.03
R7730:Lpl UTSW 8 68887448 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTCAATACCAGAGTATTTGTCG -3'
(R):5'- ATGATGAATATTGGGCACAAGC -3'

Sequencing Primer
(F):5'- TTGTCGCTTTTAGGTATAACACG -3'
(R):5'- AGCCTCCAACACCACGC -3'
Posted On2016-04-27