Mutagenetix > Incidental Mutation

Incidental Mutation 'R4962:Bean1'

381843

Institutional Source

Beutler Lab

Gene Symbol

Bean1

Ensembl Gene

ENSMUSG00000031872

Gene Name

brain expressed, associated with Nedd4, 1

Synonyms

MMRRC Submission

042559-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4962 (G1)

Quality Score

224

Status

Not validated

Chromosome

Chromosomal Location

104170442-104219122 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104216974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 54 (T54A)

Ref Sequence

ENSEMBL: ENSMUSP00000148283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]

AlphaFold

Q9EQG5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093245
AA Change: T159A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: T159A

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164076
AA Change: T98A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872
AA Change: T98A

Domain	Start	End	E-Value	Type
low complexity region	156	171	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167633
AA Change: T159A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: T159A

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171018
AA Change: T230A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: T230A

Domain	Start	End	E-Value	Type
transmembrane domain	72	94	N/A	INTRINSIC
low complexity region	104	124	N/A	INTRINSIC
low complexity region	288	303	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212627

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212672

Predicted Effect

probably damaging
Transcript: ENSMUST00000212979
AA Change: T230A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000213077
AA Change: T54A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,472,808	F317L	possibly damaging	Het
Abcc4	A	G	14: 118,668,399	I85T	probably benign	Het
Acoxl	G	T	2: 128,075,890	C498F	probably damaging	Het
Akap13	C	T	7: 75,749,430	T2752I	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ap2a2	T	G	7: 141,630,148	F836C	probably damaging	Het
Atp2c1	A	G	9: 105,442,950	V404A	probably benign	Het
Atp7b	G	T	8: 22,020,885	A415E	probably damaging	Het
Babam2	A	T	5: 31,785,583	I71L	possibly damaging	Het
Cacna1b	T	A	2: 24,618,318	I1816F	probably damaging	Het
Cacna1b	C	T	2: 24,657,366	G1202D	probably damaging	Het
Casp8ap2	A	G	4: 32,640,554	E536G	probably damaging	Het
Cfap57	A	G	4: 118,613,065	V206A	probably benign	Het
Clca2	A	T	3: 145,077,879	D658E	probably damaging	Het
Cwc22	A	T	2: 77,896,309	S809T	probably benign	Het
Cyp2c54	C	T	19: 40,072,141	R132Q	possibly damaging	Het
Ddx20	A	T	3: 105,680,605	D386E	possibly damaging	Het
Ddx50	T	C	10: 62,642,853	T185A	probably damaging	Het
Decr1	G	A	4: 15,930,976	R119*	probably null	Het
Dennd4a	T	C	9: 64,906,003	S1415P	probably benign	Het
Dnah12	A	T	14: 26,716,700	I495L	probably benign	Het
Dnah2	G	A	11: 69,455,973	Q2596*	probably null	Het
Dnajb13	A	G	7: 100,507,500	L123S	probably benign	Het
Elavl3	G	A	9: 22,036,811	P19L	probably benign	Het
Fer1l6	T	C	15: 58,571,401	S518P	probably benign	Het
Fgd3	T	C	13: 49,266,629	S591G	probably benign	Het
Galnt18	C	A	7: 111,472,064	R566L	probably benign	Het
Galnt6	A	T	15: 100,696,574	Y525*	probably null	Het
Gm10036	A	T	18: 15,833,302	Y170F	probably benign	Het
Hacd2	A	G	16: 35,022,551	D24G	unknown	Het
Idh3a	T	C	9: 54,596,041	M128T	possibly damaging	Het
Ido1	C	T	8: 24,584,549	M359I	probably benign	Het
Ikbkb	T	C	8: 22,681,677	T185A	probably damaging	Het
Insl6	C	T	19: 29,321,619	G131D	probably damaging	Het
Irgm1	A	C	11: 48,866,332	S217R	possibly damaging	Het
Itga11	T	A	9: 62,761,568	Y702*	probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kansl2	T	C	15: 98,531,843	M103V	probably benign	Het
Kcnq2	T	C	2: 181,112,043	N258S	possibly damaging	Het
Kdm5d	A	T	Y: 940,624	D1045V	probably damaging	Het
Lats2	A	G	14: 57,699,592	L480P	probably damaging	Het
Lin28b	T	A	10: 45,420,640	K87N	possibly damaging	Het
Lpgat1	T	A	1: 191,719,570	W103R	probably damaging	Het
Lpl	G	T	8: 68,894,693	G166C	probably damaging	Het
Ly75	A	T	2: 60,352,125	Y569N	probably damaging	Het
Mcm8	A	T	2: 132,838,769	E564D	probably damaging	Het
Me2	G	T	18: 73,785,776	N411K	probably damaging	Het
Mn1	A	G	5: 111,454,786	T1297A	possibly damaging	Het
Mphosph8	T	A	14: 56,678,589	F447L	probably benign	Het
Nacad	T	A	11: 6,599,169	D1294V	probably damaging	Het
Neu3	A	T	7: 99,823,408	F41I	probably damaging	Het
Nlrp6	G	T	7: 140,923,584	L534F	probably damaging	Het
Nrap	A	G	19: 56,378,143	M338T	probably damaging	Het
Nuak1	T	C	10: 84,375,115	K370E	probably damaging	Het
Olfr1151	A	G	2: 87,857,288	T38A	probably benign	Het
Olfr1425	T	A	19: 12,074,275	D119V	probably damaging	Het
Olfr479	T	A	7: 108,055,440	C153S	probably benign	Het
Olfr805	C	T	10: 129,722,723	V274M	probably damaging	Het
P3h3	T	C	6: 124,841,773	S701G	probably benign	Het
Pdss2	T	C	10: 43,298,912	M138T	possibly damaging	Het
Piezo1	C	T	8: 122,486,481	E1848K	probably benign	Het
Prmt3	T	G	7: 49,826,809	S389A	probably benign	Het
Prrxl1	G	T	14: 32,647,144		probably benign	Het
Prune2	T	A	19: 17,122,273	F1714I	probably benign	Het
Ptgis	A	G	2: 167,225,274		probably null	Het
Ptpn20	T	C	14: 33,614,459	V85A	probably benign	Het
Rabepk	A	T	2: 34,780,657	Y264N	probably damaging	Het
Ralgapa2	A	T	2: 146,434,834	C495*	probably null	Het
Satb2	A	G	1: 56,891,168	I232T	probably benign	Het
Selenbp2	A	T	3: 94,703,549	L307F	probably damaging	Het
Sgpl1	T	G	10: 61,114,084	Y112S	probably damaging	Het
Slitrk5	T	C	14: 111,681,247	S768P	probably benign	Het
Smc3	T	A	19: 53,631,517	Y615N	probably damaging	Het
Spag17	A	G	3: 100,027,623	N715S	probably benign	Het
Spats2	A	G	15: 99,212,276	E518G	probably benign	Het
Spats2l	A	G	1: 57,885,824	H127R	possibly damaging	Het
Tenm3	T	A	8: 48,278,961	K1287*	probably null	Het
Thoc1	T	A	18: 9,962,387	S91T	probably benign	Het
Thoc6	C	T	17: 23,669,937	G166S	probably damaging	Het
Tmem107	C	A	11: 69,071,261	T42N	possibly damaging	Het
Tmprss11c	A	G	5: 86,237,710	I288T	probably damaging	Het
Tnrc18	A	G	5: 142,739,493	F1827S	unknown	Het
Trmt112	C	A	19: 6,910,198	T5N	probably damaging	Het
Trp53bp1	A	T	2: 121,270,546	M57K	probably benign	Het
Ttbk2	C	A	2: 120,745,150	Q1115H	probably damaging	Het
Ttn	C	A	2: 76,729,645	E27725*	probably null	Het
Ttn	A	G	2: 76,944,109	M2151T	probably damaging	Het
Usp9y	A	T	Y: 1,384,336	D727E	probably damaging	Het
Vps13c	A	G	9: 67,873,891	T221A	probably damaging	Het
Zbtb20	A	G	16: 43,618,692	D725G	probably damaging	Het
Zfp341	A	T	2: 154,626,814	I126F	possibly damaging	Het
Zfyve16	C	T	13: 92,513,894	A861T	probably damaging	Het

Other mutations in Bean1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02016:Bean1	APN	8	104210918	missense	possibly damaging	0.90
R0135:Bean1	UTSW	8	104217175	missense	probably damaging	1.00
R0490:Bean1	UTSW	8	104215028	missense	possibly damaging	0.76
R1319:Bean1	UTSW	8	104217224	missense	probably benign
R1920:Bean1	UTSW	8	104211110	missense	possibly damaging	0.92
R2513:Bean1	UTSW	8	104182011	missense	probably benign	0.04
R3980:Bean1	UTSW	8	104211098	missense	possibly damaging	0.92
R4209:Bean1	UTSW	8	104213934	start codon destroyed	probably null	0.04
R4369:Bean1	UTSW	8	104217110	missense	probably damaging	1.00
R4516:Bean1	UTSW	8	104215154	missense	probably damaging	1.00
R4542:Bean1	UTSW	8	104210959	missense	probably damaging	1.00
R4663:Bean1	UTSW	8	104211167	missense	probably damaging	1.00
R5221:Bean1	UTSW	8	104215152	missense	probably damaging	1.00
R6288:Bean1	UTSW	8	104210990	missense	probably damaging	1.00
R6588:Bean1	UTSW	8	104182032	frame shift	probably null
R6615:Bean1	UTSW	8	104182032	frame shift	probably null
R6994:Bean1	UTSW	8	104182032	frame shift	probably null
R7359:Bean1	UTSW	8	104182032	frame shift	probably null
R7451:Bean1	UTSW	8	104213996	missense	probably benign	0.01
R7454:Bean1	UTSW	8	104211026	missense	probably damaging	1.00
R7473:Bean1	UTSW	8	104182032	frame shift	probably null
R7537:Bean1	UTSW	8	104182032	frame shift	probably null
R7826:Bean1	UTSW	8	104182032	frame shift	probably null
R8034:Bean1	UTSW	8	104182032	frame shift	probably null
R8418:Bean1	UTSW	8	104182032	frame shift	probably null
R8789:Bean1	UTSW	8	104182032	frame shift	probably null
R8885:Bean1	UTSW	8	104182120	critical splice donor site	probably null
R8888:Bean1	UTSW	8	104182032	frame shift	probably null
R8892:Bean1	UTSW	8	104216978	missense	probably damaging	1.00
R8896:Bean1	UTSW	8	104182032	frame shift	probably null
R8992:Bean1	UTSW	8	104182032	frame shift	probably null
R9015:Bean1	UTSW	8	104182032	frame shift	probably null
R9113:Bean1	UTSW	8	104213925	missense	probably benign	0.00
R9122:Bean1	UTSW	8	104182032	frame shift	probably null
R9135:Bean1	UTSW	8	104182032	frame shift	probably null
R9151:Bean1	UTSW	8	104182032	frame shift	probably null
R9255:Bean1	UTSW	8	104182032	frame shift	probably null
R9340:Bean1	UTSW	8	104182107	missense	probably damaging	0.99
R9363:Bean1	UTSW	8	104182032	frame shift	probably null
R9417:Bean1	UTSW	8	104182032	frame shift	probably null
R9537:Bean1	UTSW	8	104182032	frame shift	probably null
R9566:Bean1	UTSW	8	104182032	frame shift	probably null
R9731:Bean1	UTSW	8	104182032	frame shift	probably null
RF054:Bean1	UTSW	8	104182032	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCAAGTCTGACCCAGCTAAGG -3'
(R):5'- AGCTTCATAAGGTGGCAGTG -3'

Sequencing Primer
(F):5'- TCTCATGGGAGCCAGCATATATG -3'
(R):5'- GCAGTGTGTCCATGGAGAC -3'

Posted On

2016-04-27