Mutagenetix > Incidental Mutation

Incidental Mutation 'R4962:Itga11'

381847

Institutional Source

Beutler Lab

Gene Symbol

Itga11

Ensembl Gene

ENSMUSG00000032243

Gene Name

integrin alpha 11

Synonyms

MMRRC Submission

042559-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R4962 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62677826-62783982 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 62761568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 702 (Y702*)

Ref Sequence

ENSEMBL: ENSMUSP00000034774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034774]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000034774
AA Change: Y702*

SMART Domains

Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: Y702*

Domain	Start	End	E-Value	Type
Int_alpha	37	90	3.9e-7	SMART
VWA	162	350	2.74e-38	SMART
Int_alpha	421	472	2.19e-1	SMART
Int_alpha	476	532	3.75e-9	SMART
Int_alpha	538	593	1.39e-12	SMART
Int_alpha	600	654	1.08e0	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159012

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,472,808	F317L	possibly damaging	Het
Abcc4	A	G	14: 118,668,399	I85T	probably benign	Het
Acoxl	G	T	2: 128,075,890	C498F	probably damaging	Het
Akap13	C	T	7: 75,749,430	T2752I	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ap2a2	T	G	7: 141,630,148	F836C	probably damaging	Het
Atp2c1	A	G	9: 105,442,950	V404A	probably benign	Het
Atp7b	G	T	8: 22,020,885	A415E	probably damaging	Het
Babam2	A	T	5: 31,785,583	I71L	possibly damaging	Het
Bean1	A	G	8: 104,216,974	T54A	probably damaging	Het
Cacna1b	T	A	2: 24,618,318	I1816F	probably damaging	Het
Cacna1b	C	T	2: 24,657,366	G1202D	probably damaging	Het
Casp8ap2	A	G	4: 32,640,554	E536G	probably damaging	Het
Cfap57	A	G	4: 118,613,065	V206A	probably benign	Het
Clca2	A	T	3: 145,077,879	D658E	probably damaging	Het
Cwc22	A	T	2: 77,896,309	S809T	probably benign	Het
Cyp2c54	C	T	19: 40,072,141	R132Q	possibly damaging	Het
Ddx20	A	T	3: 105,680,605	D386E	possibly damaging	Het
Ddx50	T	C	10: 62,642,853	T185A	probably damaging	Het
Decr1	G	A	4: 15,930,976	R119*	probably null	Het
Dennd4a	T	C	9: 64,906,003	S1415P	probably benign	Het
Dnah12	A	T	14: 26,716,700	I495L	probably benign	Het
Dnah2	G	A	11: 69,455,973	Q2596*	probably null	Het
Dnajb13	A	G	7: 100,507,500	L123S	probably benign	Het
Elavl3	G	A	9: 22,036,811	P19L	probably benign	Het
Fer1l6	T	C	15: 58,571,401	S518P	probably benign	Het
Fgd3	T	C	13: 49,266,629	S591G	probably benign	Het
Galnt18	C	A	7: 111,472,064	R566L	probably benign	Het
Galnt6	A	T	15: 100,696,574	Y525*	probably null	Het
Gm10036	A	T	18: 15,833,302	Y170F	probably benign	Het
Hacd2	A	G	16: 35,022,551	D24G	unknown	Het
Idh3a	T	C	9: 54,596,041	M128T	possibly damaging	Het
Ido1	C	T	8: 24,584,549	M359I	probably benign	Het
Ikbkb	T	C	8: 22,681,677	T185A	probably damaging	Het
Insl6	C	T	19: 29,321,619	G131D	probably damaging	Het
Irgm1	A	C	11: 48,866,332	S217R	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kansl2	T	C	15: 98,531,843	M103V	probably benign	Het
Kcnq2	T	C	2: 181,112,043	N258S	possibly damaging	Het
Kdm5d	A	T	Y: 940,624	D1045V	probably damaging	Het
Lats2	A	G	14: 57,699,592	L480P	probably damaging	Het
Lin28b	T	A	10: 45,420,640	K87N	possibly damaging	Het
Lpgat1	T	A	1: 191,719,570	W103R	probably damaging	Het
Lpl	G	T	8: 68,894,693	G166C	probably damaging	Het
Ly75	A	T	2: 60,352,125	Y569N	probably damaging	Het
Mcm8	A	T	2: 132,838,769	E564D	probably damaging	Het
Me2	G	T	18: 73,785,776	N411K	probably damaging	Het
Mn1	A	G	5: 111,454,786	T1297A	possibly damaging	Het
Mphosph8	T	A	14: 56,678,589	F447L	probably benign	Het
Nacad	T	A	11: 6,599,169	D1294V	probably damaging	Het
Neu3	A	T	7: 99,823,408	F41I	probably damaging	Het
Nlrp6	G	T	7: 140,923,584	L534F	probably damaging	Het
Nrap	A	G	19: 56,378,143	M338T	probably damaging	Het
Nuak1	T	C	10: 84,375,115	K370E	probably damaging	Het
Olfr1151	A	G	2: 87,857,288	T38A	probably benign	Het
Olfr1425	T	A	19: 12,074,275	D119V	probably damaging	Het
Olfr479	T	A	7: 108,055,440	C153S	probably benign	Het
Olfr805	C	T	10: 129,722,723	V274M	probably damaging	Het
P3h3	T	C	6: 124,841,773	S701G	probably benign	Het
Pdss2	T	C	10: 43,298,912	M138T	possibly damaging	Het
Piezo1	C	T	8: 122,486,481	E1848K	probably benign	Het
Prmt3	T	G	7: 49,826,809	S389A	probably benign	Het
Prrxl1	G	T	14: 32,647,144		probably benign	Het
Prune2	T	A	19: 17,122,273	F1714I	probably benign	Het
Ptgis	A	G	2: 167,225,274		probably null	Het
Ptpn20	T	C	14: 33,614,459	V85A	probably benign	Het
Rabepk	A	T	2: 34,780,657	Y264N	probably damaging	Het
Ralgapa2	A	T	2: 146,434,834	C495*	probably null	Het
Satb2	A	G	1: 56,891,168	I232T	probably benign	Het
Selenbp2	A	T	3: 94,703,549	L307F	probably damaging	Het
Sgpl1	T	G	10: 61,114,084	Y112S	probably damaging	Het
Slitrk5	T	C	14: 111,681,247	S768P	probably benign	Het
Smc3	T	A	19: 53,631,517	Y615N	probably damaging	Het
Spag17	A	G	3: 100,027,623	N715S	probably benign	Het
Spats2	A	G	15: 99,212,276	E518G	probably benign	Het
Spats2l	A	G	1: 57,885,824	H127R	possibly damaging	Het
Tenm3	T	A	8: 48,278,961	K1287*	probably null	Het
Thoc1	T	A	18: 9,962,387	S91T	probably benign	Het
Thoc6	C	T	17: 23,669,937	G166S	probably damaging	Het
Tmem107	C	A	11: 69,071,261	T42N	possibly damaging	Het
Tmprss11c	A	G	5: 86,237,710	I288T	probably damaging	Het
Tnrc18	A	G	5: 142,739,493	F1827S	unknown	Het
Trmt112	C	A	19: 6,910,198	T5N	probably damaging	Het
Trp53bp1	A	T	2: 121,270,546	M57K	probably benign	Het
Ttbk2	C	A	2: 120,745,150	Q1115H	probably damaging	Het
Ttn	C	A	2: 76,729,645	E27725*	probably null	Het
Ttn	A	G	2: 76,944,109	M2151T	probably damaging	Het
Usp9y	A	T	Y: 1,384,336	D727E	probably damaging	Het
Vps13c	A	G	9: 67,873,891	T221A	probably damaging	Het
Zbtb20	A	G	16: 43,618,692	D725G	probably damaging	Het
Zfp341	A	T	2: 154,626,814	I126F	possibly damaging	Het
Zfyve16	C	T	13: 92,513,894	A861T	probably damaging	Het

Other mutations in Itga11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Itga11	APN	9	62769305	missense	possibly damaging	0.58
IGL01108:Itga11	APN	9	62757621	missense	probably benign
IGL01348:Itga11	APN	9	62744579	missense	possibly damaging	0.83
IGL01739:Itga11	APN	9	62774117	missense	probably benign	0.03
IGL01918:Itga11	APN	9	62772996	missense	probably benign	0.05
IGL02237:Itga11	APN	9	62755775	critical splice donor site	probably null
IGL02418:Itga11	APN	9	62744632	missense	probably benign	0.30
IGL02451:Itga11	APN	9	62735353	missense	probably damaging	1.00
sneezy	UTSW	9	62732109	missense	probably damaging	1.00
PIT4812001:Itga11	UTSW	9	62732193	missense	probably damaging	1.00
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0101:Itga11	UTSW	9	62744486	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62735293	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62760302	missense	possibly damaging	0.85
R0212:Itga11	UTSW	9	62745969	missense	probably benign	0.22
R0310:Itga11	UTSW	9	62760346	missense	probably damaging	1.00
R0455:Itga11	UTSW	9	62696961	missense	probably damaging	1.00
R0558:Itga11	UTSW	9	62752288	missense	probably benign	0.01
R0607:Itga11	UTSW	9	62774371	missense	probably benign	0.00
R0924:Itga11	UTSW	9	62776674	missense	probably benign	0.14
R1085:Itga11	UTSW	9	62677970	missense	probably benign	0.03
R1477:Itga11	UTSW	9	62755211	missense	probably benign
R1647:Itga11	UTSW	9	62760370	missense	probably benign	0.01
R1831:Itga11	UTSW	9	62782018	missense	probably damaging	1.00
R1880:Itga11	UTSW	9	62677949	missense	probably benign	0.06
R1934:Itga11	UTSW	9	62744514	missense	probably damaging	1.00
R2025:Itga11	UTSW	9	62762811	missense	probably damaging	1.00
R2046:Itga11	UTSW	9	62727697	missense	probably damaging	1.00
R2145:Itga11	UTSW	9	62732204	splice site	probably benign
R2922:Itga11	UTSW	9	62768630	splice site	probably benign
R3011:Itga11	UTSW	9	62696980	missense	probably damaging	0.99
R3158:Itga11	UTSW	9	62769278	missense	probably benign	0.02
R3809:Itga11	UTSW	9	62771382	missense	probably benign
R3836:Itga11	UTSW	9	62769283	missense	probably benign	0.00
R4051:Itga11	UTSW	9	62755651	nonsense	probably null
R4190:Itga11	UTSW	9	62732109	missense	probably damaging	1.00
R4510:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4511:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4678:Itga11	UTSW	9	62735357	missense	probably damaging	0.98
R4706:Itga11	UTSW	9	62755296	missense	possibly damaging	0.64
R4713:Itga11	UTSW	9	62765788	missense	probably damaging	1.00
R4798:Itga11	UTSW	9	62776727	splice site	probably null
R4909:Itga11	UTSW	9	62755299	missense	probably damaging	1.00
R4915:Itga11	UTSW	9	62752248	nonsense	probably null
R4957:Itga11	UTSW	9	62767648	missense	probably benign	0.00
R5081:Itga11	UTSW	9	62755196	missense	probably benign	0.13
R5265:Itga11	UTSW	9	62737412	missense	probably benign	0.05
R5308:Itga11	UTSW	9	62755769	missense	probably benign
R5398:Itga11	UTSW	9	62745923	missense	probably benign	0.21
R5717:Itga11	UTSW	9	62752249	missense	probably benign	0.26
R5885:Itga11	UTSW	9	62762850	missense	probably damaging	0.99
R5996:Itga11	UTSW	9	62755673	missense	probably benign	0.01
R6394:Itga11	UTSW	9	62735266	splice site	probably null
R6751:Itga11	UTSW	9	62768584	missense	probably benign	0.02
R7041:Itga11	UTSW	9	62752256	missense	probably damaging	1.00
R7264:Itga11	UTSW	9	62745908	missense	probably benign	0.02
R7509:Itga11	UTSW	9	62781940	missense	probably benign
R7601:Itga11	UTSW	9	62696926	missense	probably benign	0.18
R7615:Itga11	UTSW	9	62744018	missense	probably benign	0.00
R8263:Itga11	UTSW	9	62696980	missense	possibly damaging	0.86
R8285:Itga11	UTSW	9	62752258	missense	probably damaging	1.00
R8419:Itga11	UTSW	9	62755178	missense	possibly damaging	0.59
R8422:Itga11	UTSW	9	62767678	missense	probably benign	0.00
R8469:Itga11	UTSW	9	62771398	missense	probably benign	0.00
R8475:Itga11	UTSW	9	62744045	missense	probably damaging	1.00
R8871:Itga11	UTSW	9	62761541	nonsense	probably null
R8904:Itga11	UTSW	9	62757611	missense	probably benign
R8954:Itga11	UTSW	9	62769263	missense	possibly damaging	0.58
R8977:Itga11	UTSW	9	62755640	missense	probably damaging	0.98
R9011:Itga11	UTSW	9	62755627	missense	probably benign	0.43
R9038:Itga11	UTSW	9	62767757	missense	possibly damaging	0.90
R9089:Itga11	UTSW	9	62771380	missense	probably damaging	1.00
R9262:Itga11	UTSW	9	62752396	splice site	probably benign
R9327:Itga11	UTSW	9	62730752	missense	probably damaging	1.00
R9487:Itga11	UTSW	9	62762889	missense	probably benign	0.35
R9794:Itga11	UTSW	9	62755586	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCTTGCTCCCATCGTGGAAG -3'
(R):5'- AAGGTGAGCCATGCTGCTTC -3'

Sequencing Primer
(F):5'- TCCCATCGTGGAAGCTTCTGG -3'
(R):5'- ATGAGGCTCTCACTTCTACAGATG -3'

Posted On

2016-04-27