Incidental Mutation 'R4962:Vps13c'
ID381848
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission 042559-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4962 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67873891 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 221 (T221A)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]
Predicted Effect probably damaging
Transcript: ENSMUST00000077879
AA Change: T221A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: T221A

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217386
AA Change: T221A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,808 F317L possibly damaging Het
Abcc4 A G 14: 118,668,399 I85T probably benign Het
Acoxl G T 2: 128,075,890 C498F probably damaging Het
Akap13 C T 7: 75,749,430 T2752I probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ap2a2 T G 7: 141,630,148 F836C probably damaging Het
Atp2c1 A G 9: 105,442,950 V404A probably benign Het
Atp7b G T 8: 22,020,885 A415E probably damaging Het
Babam2 A T 5: 31,785,583 I71L possibly damaging Het
Bean1 A G 8: 104,216,974 T54A probably damaging Het
Cacna1b T A 2: 24,618,318 I1816F probably damaging Het
Cacna1b C T 2: 24,657,366 G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 E536G probably damaging Het
Cfap57 A G 4: 118,613,065 V206A probably benign Het
Clca2 A T 3: 145,077,879 D658E probably damaging Het
Cwc22 A T 2: 77,896,309 S809T probably benign Het
Cyp2c54 C T 19: 40,072,141 R132Q possibly damaging Het
Ddx20 A T 3: 105,680,605 D386E possibly damaging Het
Ddx50 T C 10: 62,642,853 T185A probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dennd4a T C 9: 64,906,003 S1415P probably benign Het
Dnah12 A T 14: 26,716,700 I495L probably benign Het
Dnah2 G A 11: 69,455,973 Q2596* probably null Het
Dnajb13 A G 7: 100,507,500 L123S probably benign Het
Elavl3 G A 9: 22,036,811 P19L probably benign Het
Fer1l6 T C 15: 58,571,401 S518P probably benign Het
Fgd3 T C 13: 49,266,629 S591G probably benign Het
Galnt18 C A 7: 111,472,064 R566L probably benign Het
Galnt6 A T 15: 100,696,574 Y525* probably null Het
Gm10036 A T 18: 15,833,302 Y170F probably benign Het
Hacd2 A G 16: 35,022,551 D24G unknown Het
Idh3a T C 9: 54,596,041 M128T possibly damaging Het
Ido1 C T 8: 24,584,549 M359I probably benign Het
Ikbkb T C 8: 22,681,677 T185A probably damaging Het
Insl6 C T 19: 29,321,619 G131D probably damaging Het
Irgm1 A C 11: 48,866,332 S217R possibly damaging Het
Itga11 T A 9: 62,761,568 Y702* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl2 T C 15: 98,531,843 M103V probably benign Het
Kcnq2 T C 2: 181,112,043 N258S possibly damaging Het
Kdm5d A T Y: 940,624 D1045V probably damaging Het
Lats2 A G 14: 57,699,592 L480P probably damaging Het
Lin28b T A 10: 45,420,640 K87N possibly damaging Het
Lpgat1 T A 1: 191,719,570 W103R probably damaging Het
Lpl G T 8: 68,894,693 G166C probably damaging Het
Ly75 A T 2: 60,352,125 Y569N probably damaging Het
Mcm8 A T 2: 132,838,769 E564D probably damaging Het
Me2 G T 18: 73,785,776 N411K probably damaging Het
Mn1 A G 5: 111,454,786 T1297A possibly damaging Het
Mphosph8 T A 14: 56,678,589 F447L probably benign Het
Nacad T A 11: 6,599,169 D1294V probably damaging Het
Neu3 A T 7: 99,823,408 F41I probably damaging Het
Nlrp6 G T 7: 140,923,584 L534F probably damaging Het
Nrap A G 19: 56,378,143 M338T probably damaging Het
Nuak1 T C 10: 84,375,115 K370E probably damaging Het
Olfr1151 A G 2: 87,857,288 T38A probably benign Het
Olfr1425 T A 19: 12,074,275 D119V probably damaging Het
Olfr479 T A 7: 108,055,440 C153S probably benign Het
Olfr805 C T 10: 129,722,723 V274M probably damaging Het
P3h3 T C 6: 124,841,773 S701G probably benign Het
Pdss2 T C 10: 43,298,912 M138T possibly damaging Het
Piezo1 C T 8: 122,486,481 E1848K probably benign Het
Prmt3 T G 7: 49,826,809 S389A probably benign Het
Prrxl1 G T 14: 32,647,144 probably benign Het
Prune2 T A 19: 17,122,273 F1714I probably benign Het
Ptgis A G 2: 167,225,274 probably null Het
Ptpn20 T C 14: 33,614,459 V85A probably benign Het
Rabepk A T 2: 34,780,657 Y264N probably damaging Het
Ralgapa2 A T 2: 146,434,834 C495* probably null Het
Satb2 A G 1: 56,891,168 I232T probably benign Het
Selenbp2 A T 3: 94,703,549 L307F probably damaging Het
Sgpl1 T G 10: 61,114,084 Y112S probably damaging Het
Slitrk5 T C 14: 111,681,247 S768P probably benign Het
Smc3 T A 19: 53,631,517 Y615N probably damaging Het
Spag17 A G 3: 100,027,623 N715S probably benign Het
Spats2 A G 15: 99,212,276 E518G probably benign Het
Spats2l A G 1: 57,885,824 H127R possibly damaging Het
Tenm3 T A 8: 48,278,961 K1287* probably null Het
Thoc1 T A 18: 9,962,387 S91T probably benign Het
Thoc6 C T 17: 23,669,937 G166S probably damaging Het
Tmem107 C A 11: 69,071,261 T42N possibly damaging Het
Tmprss11c A G 5: 86,237,710 I288T probably damaging Het
Tnrc18 A G 5: 142,739,493 F1827S unknown Het
Trmt112 C A 19: 6,910,198 T5N probably damaging Het
Trp53bp1 A T 2: 121,270,546 M57K probably benign Het
Ttbk2 C A 2: 120,745,150 Q1115H probably damaging Het
Ttn C A 2: 76,729,645 E27725* probably null Het
Ttn A G 2: 76,944,109 M2151T probably damaging Het
Usp9y A T Y: 1,384,336 D727E probably damaging Het
Zbtb20 A G 16: 43,618,692 D725G probably damaging Het
Zfp341 A T 2: 154,626,814 I126F possibly damaging Het
Zfyve16 C T 13: 92,513,894 A861T probably damaging Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTTATGGGAATGCTGTCTG -3'
(R):5'- TCTCTACTCGCTGGAGATCC -3'

Sequencing Primer
(F):5'- GTCTGTTTTAAAGGCTTCACAGTC -3'
(R):5'- CAGAGACACAGCATCTATTTCTTCTG -3'
Posted On2016-04-27