Incidental Mutation 'R4962:Cyp2c54'
ID 381886
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 042559-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R4962 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40060585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 132 (R132Q)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000048959
AA Change: R132Q

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: R132Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,314,728 (GRCm39) F317L possibly damaging Het
Abcc4 A G 14: 118,905,811 (GRCm39) I85T probably benign Het
Acoxl G T 2: 127,917,810 (GRCm39) C498F probably damaging Het
Akap13 C T 7: 75,399,178 (GRCm39) T2752I probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ap2a2 T G 7: 141,210,061 (GRCm39) F836C probably damaging Het
Atp2c1 A G 9: 105,320,149 (GRCm39) V404A probably benign Het
Atp7b G T 8: 22,510,901 (GRCm39) A415E probably damaging Het
Babam2 A T 5: 31,942,927 (GRCm39) I71L possibly damaging Het
Bean1 A G 8: 104,943,606 (GRCm39) T54A probably damaging Het
Cacna1b T A 2: 24,508,330 (GRCm39) I1816F probably damaging Het
Cacna1b C T 2: 24,547,378 (GRCm39) G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 (GRCm39) E536G probably damaging Het
Cfap57 A G 4: 118,470,262 (GRCm39) V206A probably benign Het
Clca3a2 A T 3: 144,783,640 (GRCm39) D658E probably damaging Het
Cwc22 A T 2: 77,726,653 (GRCm39) S809T probably benign Het
Ddx20 A T 3: 105,587,921 (GRCm39) D386E possibly damaging Het
Ddx50 T C 10: 62,478,632 (GRCm39) T185A probably damaging Het
Decr1 G A 4: 15,930,976 (GRCm39) R119* probably null Het
Dennd4a T C 9: 64,813,285 (GRCm39) S1415P probably benign Het
Dnah12 A T 14: 26,437,855 (GRCm39) I495L probably benign Het
Dnah2 G A 11: 69,346,799 (GRCm39) Q2596* probably null Het
Dnajb13 A G 7: 100,156,707 (GRCm39) L123S probably benign Het
Drgx G T 14: 32,369,101 (GRCm39) probably benign Het
Elavl3 G A 9: 21,948,107 (GRCm39) P19L probably benign Het
Fer1l6 T C 15: 58,443,250 (GRCm39) S518P probably benign Het
Fgd3 T C 13: 49,420,105 (GRCm39) S591G probably benign Het
Galnt18 C A 7: 111,071,271 (GRCm39) R566L probably benign Het
Galnt6 A T 15: 100,594,455 (GRCm39) Y525* probably null Het
Gm10036 A T 18: 15,966,359 (GRCm39) Y170F probably benign Het
Hacd2 A G 16: 34,842,921 (GRCm39) D24G unknown Het
Idh3a T C 9: 54,503,325 (GRCm39) M128T possibly damaging Het
Ido1 C T 8: 25,074,565 (GRCm39) M359I probably benign Het
Ikbkb T C 8: 23,171,693 (GRCm39) T185A probably damaging Het
Insl6 C T 19: 29,299,019 (GRCm39) G131D probably damaging Het
Irgm1 A C 11: 48,757,159 (GRCm39) S217R possibly damaging Het
Itga11 T A 9: 62,668,850 (GRCm39) Y702* probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kansl2 T C 15: 98,429,724 (GRCm39) M103V probably benign Het
Kcnq2 T C 2: 180,753,836 (GRCm39) N258S possibly damaging Het
Kdm5d A T Y: 940,624 (GRCm39) D1045V probably damaging Het
Lats2 A G 14: 57,937,049 (GRCm39) L480P probably damaging Het
Lin28b T A 10: 45,296,736 (GRCm39) K87N possibly damaging Het
Lpgat1 T A 1: 191,451,682 (GRCm39) W103R probably damaging Het
Lpl G T 8: 69,347,345 (GRCm39) G166C probably damaging Het
Ly75 A T 2: 60,182,469 (GRCm39) Y569N probably damaging Het
Mcm8 A T 2: 132,680,689 (GRCm39) E564D probably damaging Het
Me2 G T 18: 73,918,847 (GRCm39) N411K probably damaging Het
Mn1 A G 5: 111,602,652 (GRCm39) T1297A possibly damaging Het
Mphosph8 T A 14: 56,916,046 (GRCm39) F447L probably benign Het
Nacad T A 11: 6,549,169 (GRCm39) D1294V probably damaging Het
Neu3 A T 7: 99,472,615 (GRCm39) F41I probably damaging Het
Nlrp6 G T 7: 140,503,497 (GRCm39) L534F probably damaging Het
Nrap A G 19: 56,366,575 (GRCm39) M338T probably damaging Het
Nuak1 T C 10: 84,210,979 (GRCm39) K370E probably damaging Het
Or10ab4 T A 7: 107,654,647 (GRCm39) C153S probably benign Het
Or4d10 T A 19: 12,051,639 (GRCm39) D119V probably damaging Het
Or5w8 A G 2: 87,687,632 (GRCm39) T38A probably benign Het
Or6c212 C T 10: 129,558,592 (GRCm39) V274M probably damaging Het
P3h3 T C 6: 124,818,736 (GRCm39) S701G probably benign Het
Pdss2 T C 10: 43,174,908 (GRCm39) M138T possibly damaging Het
Piezo1 C T 8: 123,213,220 (GRCm39) E1848K probably benign Het
Prmt3 T G 7: 49,476,557 (GRCm39) S389A probably benign Het
Prune2 T A 19: 17,099,637 (GRCm39) F1714I probably benign Het
Ptgis A G 2: 167,067,194 (GRCm39) probably null Het
Ptpn20 T C 14: 33,336,416 (GRCm39) V85A probably benign Het
Rabepk A T 2: 34,670,669 (GRCm39) Y264N probably damaging Het
Ralgapa2 A T 2: 146,276,754 (GRCm39) C495* probably null Het
Satb2 A G 1: 56,930,327 (GRCm39) I232T probably benign Het
Selenbp2 A T 3: 94,610,856 (GRCm39) L307F probably damaging Het
Sgpl1 T G 10: 60,949,863 (GRCm39) Y112S probably damaging Het
Slitrk5 T C 14: 111,918,679 (GRCm39) S768P probably benign Het
Smc3 T A 19: 53,619,948 (GRCm39) Y615N probably damaging Het
Spag17 A G 3: 99,934,939 (GRCm39) N715S probably benign Het
Spats2 A G 15: 99,110,157 (GRCm39) E518G probably benign Het
Spats2l A G 1: 57,924,983 (GRCm39) H127R possibly damaging Het
Tenm3 T A 8: 48,731,996 (GRCm39) K1287* probably null Het
Thoc1 T A 18: 9,962,387 (GRCm39) S91T probably benign Het
Thoc6 C T 17: 23,888,911 (GRCm39) G166S probably damaging Het
Tmem107 C A 11: 68,962,087 (GRCm39) T42N possibly damaging Het
Tmprss11c A G 5: 86,385,569 (GRCm39) I288T probably damaging Het
Tnrc18 A G 5: 142,725,248 (GRCm39) F1827S unknown Het
Trmt112 C A 19: 6,887,566 (GRCm39) T5N probably damaging Het
Trp53bp1 A T 2: 121,101,027 (GRCm39) M57K probably benign Het
Ttbk2 C A 2: 120,575,631 (GRCm39) Q1115H probably damaging Het
Ttn C A 2: 76,559,989 (GRCm39) E27725* probably null Het
Ttn A G 2: 76,774,453 (GRCm39) M2151T probably damaging Het
Usp9y A T Y: 1,384,336 (GRCm39) D727E probably damaging Het
Vps13c A G 9: 67,781,173 (GRCm39) T221A probably damaging Het
Zbtb20 A G 16: 43,439,055 (GRCm39) D725G probably damaging Het
Zfp341 A T 2: 154,468,734 (GRCm39) I126F possibly damaging Het
Zfyve16 C T 13: 92,650,402 (GRCm39) A861T probably damaging Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGACATGAGACCTATACACCTCATTAG -3'
(R):5'- CAACTCTGTGCCTGAGACAC -3'

Sequencing Primer
(F):5'- TCAAATGCTATCCCAAATGTTCC -3'
(R):5'- CCTGAGACACAGTTTGGGATTC -3'
Posted On 2016-04-27