Incidental Mutation 'R4950:Gpr155'
List |< first << previous [record 19 of 53] next >> last >|
ID381895
Institutional Source Beutler Lab
Gene Symbol Gpr155
Ensembl Gene ENSMUSG00000041762
Gene NameG protein-coupled receptor 155
SynonymsPGR22, 1110017O10Rik, DEPDC3, F730029F15Rik
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location73341506-73386572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73382185 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 31 (D31E)
Ref Sequence ENSEMBL: ENSMUSP00000107675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076463] [ENSMUST00000112043] [ENSMUST00000112044]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048504
SMART Domains Protein: ENSMUSP00000037772
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 1.9e-16 PFAM
Pfam:Mem_trans 187 360 4.9e-12 PFAM
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076463
AA Change: D31E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075788
Gene: ENSMUSG00000041762
AA Change: D31E

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112043
AA Change: D31E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107674
Gene: ENSMUSG00000041762
AA Change: D31E

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112044
AA Change: D31E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107675
Gene: ENSMUSG00000041762
AA Change: D31E

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
Pfam:Mem_trans 187 360 8.3e-11 PFAM
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 414 436 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
transmembrane domain 629 651 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
DEP 731 805 8.28e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184503
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Gpr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gpr155 APN 2 73362613 missense probably damaging 1.00
IGL01432:Gpr155 APN 2 73351885 missense possibly damaging 0.51
IGL01528:Gpr155 APN 2 73362423 critical splice donor site probably null
IGL01718:Gpr155 APN 2 73382232 missense probably benign
IGL01733:Gpr155 APN 2 73353612 splice site probably null
IGL03342:Gpr155 APN 2 73349678 missense probably damaging 1.00
PIT1430001:Gpr155 UTSW 2 73370138 missense probably benign 0.08
PIT4810001:Gpr155 UTSW 2 73348263 missense probably benign 0.08
R0226:Gpr155 UTSW 2 73367592 missense probably benign 0.02
R0399:Gpr155 UTSW 2 73370002 missense possibly damaging 0.91
R0445:Gpr155 UTSW 2 73370144 splice site probably benign
R1570:Gpr155 UTSW 2 73370038 missense possibly damaging 0.87
R1598:Gpr155 UTSW 2 73370090 missense probably damaging 0.98
R1647:Gpr155 UTSW 2 73364164 splice site probably null
R1648:Gpr155 UTSW 2 73364164 splice site probably null
R1756:Gpr155 UTSW 2 73367577 missense probably benign 0.00
R1760:Gpr155 UTSW 2 73381935 missense probably damaging 1.00
R2033:Gpr155 UTSW 2 73348182 missense probably benign 0.18
R2044:Gpr155 UTSW 2 73373633 missense probably damaging 1.00
R2145:Gpr155 UTSW 2 73356658 missense probably benign 0.01
R2172:Gpr155 UTSW 2 73382127 missense probably benign 0.00
R2274:Gpr155 UTSW 2 73348135 critical splice donor site probably null
R3878:Gpr155 UTSW 2 73368392 nonsense probably null
R3924:Gpr155 UTSW 2 73370076 missense probably damaging 1.00
R4910:Gpr155 UTSW 2 73367538 nonsense probably null
R5337:Gpr155 UTSW 2 73348248 missense probably benign 0.32
R5830:Gpr155 UTSW 2 73370089 missense possibly damaging 0.93
R5887:Gpr155 UTSW 2 73343718 nonsense probably null
R5929:Gpr155 UTSW 2 73373667 nonsense probably null
R6293:Gpr155 UTSW 2 73373997 missense possibly damaging 0.47
R6553:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R6585:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R7003:Gpr155 UTSW 2 73343617 missense probably damaging 0.99
R7353:Gpr155 UTSW 2 73367491 nonsense probably null
R7506:Gpr155 UTSW 2 73368339 missense probably damaging 0.97
R7631:Gpr155 UTSW 2 73382947 intron probably benign
R7753:Gpr155 UTSW 2 73382206 missense probably benign 0.27
R7810:Gpr155 UTSW 2 73381952 missense probably damaging 0.99
R7813:Gpr155 UTSW 2 73381985 nonsense probably null
R7815:Gpr155 UTSW 2 73362560 missense probably benign
R7873:Gpr155 UTSW 2 73343590 missense possibly damaging 0.51
R8506:Gpr155 UTSW 2 73343462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAAAGCCCAGTCCACGTTG -3'
(R):5'- TGCCACAGTCTGTTTCAGTC -3'

Sequencing Primer
(F):5'- TCCACGTTGGAAAAATTAAGCAC -3'
(R):5'- CAGTCTGTGGCTGGTCTTAACAC -3'
Posted On2016-04-27