Incidental Mutation 'R4950:Ccdc73'
ID 381898
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Name coiled-coil domain containing 73
Synonyms 2210415I11Rik
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R4950 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 104867805-105017904 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 104992366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 887 (I887L)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
AlphaFold Q8CDM4
Predicted Effect probably benign
Transcript: ENSMUST00000111114
AA Change: I887L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: I887L

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144358
AA Change: I59L
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106
AA Change: I59L

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 (GRCm38) D215V probably damaging Het
Cacna1i A G 15: 80,368,671 (GRCm38) E625G probably damaging Het
Cage1 C T 13: 38,023,326 (GRCm38) S181N possibly damaging Het
Cfap65 T A 1: 74,906,336 (GRCm38) K1408* probably null Het
Cngb1 C A 8: 95,248,507 (GRCm38) G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 (GRCm38) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm38) S99P probably benign Het
Disp3 A T 4: 148,258,126 (GRCm38) D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 (GRCm38) V267I probably benign Het
Dph5 G A 3: 115,928,643 (GRCm38) G257S probably benign Het
Elmo2 A T 2: 165,314,813 (GRCm38) probably null Het
Fam186a T C 15: 99,941,653 (GRCm38) R2237G unknown Het
Fez1 G A 9: 36,867,882 (GRCm38) R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 (GRCm38) H101L probably damaging Het
Fsip2 G A 2: 82,977,414 (GRCm38) C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 (GRCm38) T15I probably benign Het
Gpr155 A T 2: 73,382,185 (GRCm38) D31E probably benign Het
Iho1 A C 9: 108,421,510 (GRCm38) S36R probably damaging Het
Irx6 A T 8: 92,678,800 (GRCm38) Y432F probably damaging Het
Itih5 A C 2: 10,235,081 (GRCm38) I340L probably damaging Het
Lao1 T C 4: 118,965,375 (GRCm38) L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 (GRCm38) I490T probably damaging Het
Mef2b T C 8: 70,167,196 (GRCm38) Y311H probably damaging Het
Mras A T 9: 99,394,484 (GRCm38) L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 (GRCm38) D475G probably damaging Het
Nrcam T C 12: 44,598,490 (GRCm38) I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 (GRCm38) probably null Het
Or7e165 G A 9: 19,783,731 (GRCm38) M199I probably benign Het
Or8b38 T C 9: 38,062,001 (GRCm38) I227T probably damaging Het
Parp9 A T 16: 35,948,007 (GRCm38) I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 (GRCm38) V421E probably benign Het
Pck1 T A 2: 173,154,827 (GRCm38) I178K probably benign Het
Pde6b A G 5: 108,430,703 (GRCm38) K836E probably benign Het
Ptprd T A 4: 76,140,515 (GRCm38) probably null Het
Pwp2 A G 10: 78,183,006 (GRCm38) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,970,921 (GRCm38) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 (GRCm38) probably null Het
Rubcn A T 16: 32,843,193 (GRCm38) S358T probably damaging Het
Ryr2 G A 13: 11,742,011 (GRCm38) R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 (GRCm38) I669V probably benign Het
Slx1b T C 7: 126,691,767 (GRCm38) probably benign Het
Spsb3 T A 17: 24,887,511 (GRCm38) probably benign Het
Tbx15 A G 3: 99,326,384 (GRCm38) I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 (GRCm38) E481D probably damaging Het
Trim17 A T 11: 58,970,428 (GRCm38) D253V probably damaging Het
Trim69 A G 2: 122,178,746 (GRCm38) D429G probably damaging Het
Vstm5 A G 9: 15,257,794 (GRCm38) probably null Het
Vwa3b A G 1: 37,085,332 (GRCm38) Q337R probably benign Het
Zfp113 T C 5: 138,145,472 (GRCm38) N172S probably benign Het
Zfp607a T A 7: 27,878,751 (GRCm38) H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 (GRCm38) T148I probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104,994,591 (GRCm38) missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104,907,627 (GRCm38) missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104,975,616 (GRCm38) missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104,907,568 (GRCm38) missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104,991,840 (GRCm38) unclassified probably benign
FR4737:Ccdc73 UTSW 2 104,991,840 (GRCm38) unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104,951,936 (GRCm38) missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104,980,987 (GRCm38) splice site probably benign
R0040:Ccdc73 UTSW 2 104,992,084 (GRCm38) missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104,929,570 (GRCm38) splice site probably benign
R0360:Ccdc73 UTSW 2 104,981,007 (GRCm38) missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104,991,289 (GRCm38) missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104,973,154 (GRCm38) splice site probably benign
R0839:Ccdc73 UTSW 2 104,991,097 (GRCm38) missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104,992,190 (GRCm38) missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104,991,561 (GRCm38) missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104,914,667 (GRCm38) missense possibly damaging 0.93
R1478:Ccdc73 UTSW 2 104,907,610 (GRCm38) missense possibly damaging 0.72
R1695:Ccdc73 UTSW 2 104,992,105 (GRCm38) missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104,992,292 (GRCm38) missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104,926,935 (GRCm38) missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104,999,159 (GRCm38) missense probably damaging 1.00
R1987:Ccdc73 UTSW 2 104,931,045 (GRCm38) nonsense probably null
R2938:Ccdc73 UTSW 2 104,975,635 (GRCm38) nonsense probably null
R3420:Ccdc73 UTSW 2 104,951,948 (GRCm38) splice site probably null
R3420:Ccdc73 UTSW 2 104,951,947 (GRCm38) missense probably null 1.00
R3422:Ccdc73 UTSW 2 104,951,948 (GRCm38) splice site probably null
R3422:Ccdc73 UTSW 2 104,951,947 (GRCm38) missense probably null 1.00
R3522:Ccdc73 UTSW 2 104,991,485 (GRCm38) missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104,991,343 (GRCm38) missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104,985,010 (GRCm38) missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104,981,105 (GRCm38) splice site probably null
R4793:Ccdc73 UTSW 2 105,017,782 (GRCm38) splice site probably null
R4939:Ccdc73 UTSW 2 104,992,157 (GRCm38) splice site probably null
R5093:Ccdc73 UTSW 2 105,017,766 (GRCm38) utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104,992,039 (GRCm38) missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104,989,925 (GRCm38) missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104,930,986 (GRCm38) missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104,992,137 (GRCm38) missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104,907,633 (GRCm38) missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104,992,088 (GRCm38) missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104,991,524 (GRCm38) nonsense probably null
R7062:Ccdc73 UTSW 2 104,951,878 (GRCm38) missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104,973,224 (GRCm38) missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104,999,176 (GRCm38) missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104,951,869 (GRCm38) missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104,994,570 (GRCm38) missense
R7747:Ccdc73 UTSW 2 104,929,556 (GRCm38) missense probably damaging 1.00
R7952:Ccdc73 UTSW 2 104,945,456 (GRCm38) critical splice donor site probably null
R8178:Ccdc73 UTSW 2 104,991,212 (GRCm38) missense probably benign 0.00
R8824:Ccdc73 UTSW 2 104,991,877 (GRCm38) missense possibly damaging 0.74
R8927:Ccdc73 UTSW 2 104,992,197 (GRCm38) missense
R8928:Ccdc73 UTSW 2 104,992,197 (GRCm38) missense
R8945:Ccdc73 UTSW 2 104,991,367 (GRCm38) missense probably benign 0.03
R9365:Ccdc73 UTSW 2 104,907,666 (GRCm38) missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104,992,239 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGCATGTGGCTGAATAAC -3'
(R):5'- AAGCATGGCCTTGTTTTCTTAC -3'

Sequencing Primer
(F):5'- CAGAGACAAAACAGAGGCATTAAAC -3'
(R):5'- GCATGGCCTTGTTTTCTTACCTGAC -3'
Posted On 2016-04-27