Incidental Mutation 'R4950:Elmo2'
ID 381901
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Name engulfment and cell motility 2
Synonyms CED-12, 1190002F24Rik
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.233) question?
Stock # R4950 (G1)
Quality Score 167
Status Validated
Chromosome 2
Chromosomal Location 165129951-165168399 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 165156733 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091] [ENSMUST00000126318] [ENSMUST00000128690] [ENSMUST00000133205]
AlphaFold Q8BHL5
Predicted Effect probably null
Transcript: ENSMUST00000071699
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000074046
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000094329
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000103088
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000103091
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127496
Predicted Effect probably benign
Transcript: ENSMUST00000128690
Predicted Effect probably null
Transcript: ENSMUST00000133205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149844
Predicted Effect probably null
Transcript: ENSMUST00000137188
SMART Domains Protein: ENSMUSP00000123232
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 17 172 1.6e-64 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Fam186a T C 15: 99,839,534 (GRCm39) R2237G unknown Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Or8b38 T C 9: 37,973,297 (GRCm39) I227T probably damaging Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Pwp2 A G 10: 78,018,840 (GRCm39) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,707,758 (GRCm39) probably null Het
Rubcn A T 16: 32,663,563 (GRCm39) S358T probably damaging Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Slx1b T C 7: 126,290,939 (GRCm39) probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tbx15 A G 3: 99,233,700 (GRCm39) I288V possibly damaging Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165,133,934 (GRCm39) unclassified probably benign
IGL01096:Elmo2 APN 2 165,138,907 (GRCm39) unclassified probably benign
IGL01694:Elmo2 APN 2 165,156,693 (GRCm39) missense probably benign 0.05
IGL02016:Elmo2 APN 2 165,136,932 (GRCm39) critical splice donor site probably null
IGL02402:Elmo2 APN 2 165,139,312 (GRCm39) missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165,133,627 (GRCm39) unclassified probably benign
IGL03030:Elmo2 APN 2 165,136,237 (GRCm39) missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165,140,573 (GRCm39) missense probably benign 0.01
R0046:Elmo2 UTSW 2 165,140,646 (GRCm39) missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165,140,646 (GRCm39) missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165,139,287 (GRCm39) missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165,138,810 (GRCm39) missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165,140,250 (GRCm39) missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165,146,839 (GRCm39) missense probably benign 0.38
R1799:Elmo2 UTSW 2 165,134,077 (GRCm39) missense probably damaging 1.00
R1940:Elmo2 UTSW 2 165,133,970 (GRCm39) unclassified probably benign
R2005:Elmo2 UTSW 2 165,140,199 (GRCm39) missense probably benign 0.00
R2504:Elmo2 UTSW 2 165,140,607 (GRCm39) missense probably damaging 0.96
R2915:Elmo2 UTSW 2 165,139,573 (GRCm39) unclassified probably benign
R3744:Elmo2 UTSW 2 165,157,922 (GRCm39) missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165,136,169 (GRCm39) nonsense probably null
R4419:Elmo2 UTSW 2 165,153,675 (GRCm39) splice site probably null
R4824:Elmo2 UTSW 2 165,133,922 (GRCm39) unclassified probably benign
R4888:Elmo2 UTSW 2 165,137,209 (GRCm39) missense probably benign 0.14
R5157:Elmo2 UTSW 2 165,133,627 (GRCm39) unclassified probably benign
R5535:Elmo2 UTSW 2 165,152,132 (GRCm39) missense possibly damaging 0.51
R5682:Elmo2 UTSW 2 165,139,330 (GRCm39) missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165,137,472 (GRCm39) missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165,136,192 (GRCm39) missense possibly damaging 0.89
R7022:Elmo2 UTSW 2 165,136,961 (GRCm39) missense probably damaging 0.99
R7089:Elmo2 UTSW 2 165,146,849 (GRCm39) missense possibly damaging 0.78
R7678:Elmo2 UTSW 2 165,133,664 (GRCm39) missense unknown
R8024:Elmo2 UTSW 2 165,133,775 (GRCm39) missense unknown
R8290:Elmo2 UTSW 2 165,150,923 (GRCm39) missense probably damaging 1.00
R9150:Elmo2 UTSW 2 165,140,607 (GRCm39) missense probably damaging 0.96
R9166:Elmo2 UTSW 2 165,132,438 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGGAAAGCATTCTGGAAGCC -3'
(R):5'- AGCAATGCTTAGGGGACCAG -3'

Sequencing Primer
(F):5'- AAGGTGGTCCCTCTCAGACAC -3'
(R):5'- GACAAGAACAACAGGCAGAAATGTTC -3'
Posted On 2016-04-27