Incidental Mutation 'R4950:Elmo2'
List |< first << previous [record 13 of 53] next >> last >|
ID381901
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Nameengulfment and cell motility 2
SynonymsCED-12, 1190002F24Rik
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R4950 (G1)
Quality Score167
Status Validated
Chromosome2
Chromosomal Location165288031-165326479 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 165314813 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091] [ENSMUST00000126318] [ENSMUST00000128690] [ENSMUST00000133205]
Predicted Effect probably null
Transcript: ENSMUST00000071699
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000074046
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000094329
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000103088
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000103091
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127496
Predicted Effect probably benign
Transcript: ENSMUST00000128690
Predicted Effect probably null
Transcript: ENSMUST00000133205
Predicted Effect probably null
Transcript: ENSMUST00000137188
SMART Domains Protein: ENSMUSP00000123232
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 17 172 1.6e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149844
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165292014 unclassified probably benign
IGL01096:Elmo2 APN 2 165296987 unclassified probably benign
IGL01694:Elmo2 APN 2 165314773 missense probably benign 0.05
IGL02016:Elmo2 APN 2 165295012 critical splice donor site probably null
IGL02402:Elmo2 APN 2 165297392 missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165291707 unclassified probably benign
IGL03030:Elmo2 APN 2 165294317 missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165298653 missense probably benign 0.01
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165297367 missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165296890 missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165298330 missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165304919 missense probably benign 0.38
R1799:Elmo2 UTSW 2 165292157 missense probably damaging 1.00
R1940:Elmo2 UTSW 2 165292050 unclassified probably benign
R2005:Elmo2 UTSW 2 165298279 missense probably benign 0.00
R2504:Elmo2 UTSW 2 165298687 missense probably damaging 0.96
R2915:Elmo2 UTSW 2 165297653 unclassified probably benign
R3744:Elmo2 UTSW 2 165316002 missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165294249 nonsense probably null
R4419:Elmo2 UTSW 2 165311755 splice site probably null
R4824:Elmo2 UTSW 2 165292002 unclassified probably benign
R4888:Elmo2 UTSW 2 165295289 missense probably benign 0.14
R5157:Elmo2 UTSW 2 165291707 unclassified probably benign
R5535:Elmo2 UTSW 2 165310212 missense possibly damaging 0.51
R5682:Elmo2 UTSW 2 165297410 missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165295552 missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165294272 missense possibly damaging 0.89
R7022:Elmo2 UTSW 2 165295041 missense probably damaging 0.99
R7089:Elmo2 UTSW 2 165304929 missense possibly damaging 0.78
R7678:Elmo2 UTSW 2 165291744 missense unknown
R8024:Elmo2 UTSW 2 165291855 missense unknown
R8290:Elmo2 UTSW 2 165309003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAAGCATTCTGGAAGCC -3'
(R):5'- AGCAATGCTTAGGGGACCAG -3'

Sequencing Primer
(F):5'- AAGGTGGTCCCTCTCAGACAC -3'
(R):5'- GACAAGAACAACAGGCAGAAATGTTC -3'
Posted On2016-04-27