Incidental Mutation 'R4950:Pck1'
List |< first << previous [record 33 of 53] next >> last >|
ID381902
Institutional Source Beutler Lab
Gene Symbol Pck1
Ensembl Gene ENSMUSG00000027513
Gene Namephosphoenolpyruvate carboxykinase 1, cytosolic
SynonymsPEPCK, Pck-1
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173153048-173159273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173154827 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 178 (I178K)
Ref Sequence ENSEMBL: ENSMUSP00000029017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029017]
Predicted Effect probably benign
Transcript: ENSMUST00000029017
AA Change: I178K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029017
Gene: ENSMUSG00000027513
AA Change: I178K

DomainStartEndE-ValueType
Pfam:PEPCK 29 619 3.2e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151269
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a main control point for the regulation of gluconeogenesis. The cytosolic enzyme encoded by this gene, along with GTP, catalyzes the formation of phosphoenolpyruvate from oxaloacetate, with the release of carbon dioxide and GDP. The expression of this gene can be regulated by insulin, glucocorticoids, glucagon, cAMP, and diet. Defects in this gene are a cause of cytosolic phosphoenolpyruvate carboxykinase deficiency. A mitochondrial isozyme of the encoded protein also has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early postnatal lethality, decreased body fat, decreased glycogen levels in the liver, and altered blood chemistry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Pck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Pck1 APN 2 173154118 critical splice donor site probably null
IGL00817:Pck1 APN 2 173153432 missense possibly damaging 0.47
IGL02476:Pck1 APN 2 173158282 missense probably benign
IGL02803:Pck1 APN 2 173156004 missense probably damaging 1.00
IGL02874:Pck1 APN 2 173155249 missense probably damaging 1.00
IGL02886:Pck1 APN 2 173154856 missense probably benign 0.43
Limestone UTSW 2 173158560 missense probably damaging 1.00
limpet UTSW 2 173154012 missense probably damaging 0.99
R0041:Pck1 UTSW 2 173155210 missense probably benign 0.21
R0125:Pck1 UTSW 2 173156081 nonsense probably null
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0373:Pck1 UTSW 2 173153390 start codon destroyed probably null 0.99
R0595:Pck1 UTSW 2 173157029 missense probably damaging 1.00
R1338:Pck1 UTSW 2 173158410 missense probably benign 0.18
R1623:Pck1 UTSW 2 173154718 missense probably benign 0.26
R1752:Pck1 UTSW 2 173157113 missense probably benign 0.00
R2107:Pck1 UTSW 2 173154068 missense probably benign 0.00
R2376:Pck1 UTSW 2 173157116 missense probably benign
R2883:Pck1 UTSW 2 173158575 missense probably benign 0.03
R3508:Pck1 UTSW 2 173158384 missense possibly damaging 0.61
R4718:Pck1 UTSW 2 173155221 missense probably damaging 0.99
R4853:Pck1 UTSW 2 173154714 nonsense probably null
R4907:Pck1 UTSW 2 173157023 missense probably damaging 1.00
R5073:Pck1 UTSW 2 173156977 missense probably benign 0.41
R5134:Pck1 UTSW 2 173153489 missense probably benign 0.23
R5213:Pck1 UTSW 2 173156085 nonsense probably null
R5244:Pck1 UTSW 2 173154863 missense possibly damaging 0.91
R5654:Pck1 UTSW 2 173158560 missense probably damaging 1.00
R5831:Pck1 UTSW 2 173156999 missense probably damaging 1.00
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6143:Pck1 UTSW 2 173154012 missense probably damaging 0.99
R6276:Pck1 UTSW 2 173157319 missense probably damaging 1.00
R7553:Pck1 UTSW 2 173157067 missense probably benign 0.13
R7860:Pck1 UTSW 2 173155950 missense possibly damaging 0.80
R8076:Pck1 UTSW 2 173155278 missense probably damaging 1.00
R8187:Pck1 UTSW 2 173155240 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TACCATTAGGAGGAGGAGCC -3'
(R):5'- AGGCTCTGCAAACAAGCAAG -3'

Sequencing Primer
(F):5'- AGCCGAGGATGCTCAGTG -3'
(R):5'- TGTCTGGGATCAAACTCAGGGC -3'
Posted On2016-04-27