Mutagenetix > Incidental Mutations

Incidental Mutation 'R4950:Tlr2'

381903

Institutional Source

Beutler Lab

Gene Symbol

Tlr2

Ensembl Gene

ENSMUSG00000027995

Gene Name

toll-like receptor 2

Synonyms

Ly105

MMRRC Submission

042547-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4950 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83836272-83841767 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 83837332 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 481 (E481D)

Ref Sequence

ENSEMBL: ENSMUSP00000029623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029623]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029623
AA Change: E481D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029623
Gene: ENSMUSG00000027995
AA Change: E481D

Domain	Start	End	E-Value	Type
LRR	51	74	1.45e2	SMART
LRR	75	98	2.33e2	SMART
LRR_TYP	99	122	3.69e-4	SMART
low complexity region	268	281	N/A	INTRINSIC
LRR	359	384	6.78e1	SMART
LRR	386	409	2.54e2	SMART
LRR	412	435	8.49e1	SMART
LRR_TYP	476	499	3.34e-2	SMART
LRRCT	533	586	5.04e-7	SMART
transmembrane domain	588	610	N/A	INTRINSIC
TIR	640	784	5.08e-38	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 92.9%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice demonstrate abnormal responses to bacterial and viral infections. Mice homozygous for a knock-out allele also exhibit disruption in circadian active and inactive state consolidation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	T	2: 154,311,659	D215V	probably damaging	Het
Cacna1i	A	G	15: 80,368,671	E625G	probably damaging	Het
Cage1	C	T	13: 38,023,326	S181N	possibly damaging	Het
Ccdc36	A	C	9: 108,421,510	S36R	probably damaging	Het
Ccdc73	A	C	2: 104,992,366	I887L	probably benign	Het
Cfap65	T	A	1: 74,906,336	K1408*	probably null	Het
Cngb1	C	A	8: 95,248,507	G654W	probably damaging	Het
Cxcl15	A	T	5: 90,795,245	E35D	possibly damaging	Het
Ddi1	A	G	9: 6,266,073	S99P	probably benign	Het
Disp3	A	T	4: 148,258,126	D622E	possibly damaging	Het
Dnajc22	G	A	15: 99,101,734	V267I	probably benign	Het
Dph5	G	A	3: 115,928,643	G257S	probably benign	Het
Elmo2	A	T	2: 165,314,813		probably null	Het
Fam186a	T	C	15: 99,941,653	R2237G	unknown	Het
Fez1	G	A	9: 36,867,882	R285Q	probably damaging	Het
Fsip2	A	T	2: 82,946,932	H101L	probably damaging	Het
Fsip2	G	A	2: 82,977,414	C1359Y	probably benign	Het
Fxyd7	G	A	7: 31,047,390	T15I	probably benign	Het
Gpr155	A	T	2: 73,382,185	D31E	probably benign	Het
Irx6	A	T	8: 92,678,800	Y432F	probably damaging	Het
Itih5	A	C	2: 10,235,081	I340L	probably damaging	Het
Lao1	T	C	4: 118,965,375	L164S	probably damaging	Het
Mcoln3	T	C	3: 146,139,519	I490T	probably damaging	Het
Mef2b	T	C	8: 70,167,196	Y311H	probably damaging	Het
Mras	A	T	9: 99,394,484	L111Q	probably damaging	Het
Mrc1	A	G	2: 14,271,280	D475G	probably damaging	Het
Nrcam	T	C	12: 44,598,490	I1155T	probably damaging	Het
Ntrk1	A	G	3: 87,789,611		probably null	Het
Olfr58	G	A	9: 19,783,731	M199I	probably benign	Het
Olfr885	T	C	9: 38,062,001	I227T	probably damaging	Het
Parp9	A	T	16: 35,948,007	I186F	probably damaging	Het
Pcdhac2	T	A	18: 37,145,230	V421E	probably benign	Het
Pck1	T	A	2: 173,154,827	I178K	probably benign	Het
Pde6b	A	G	5: 108,430,703	K836E	probably benign	Het
Ptprd	T	A	4: 76,140,515		probably null	Het
Pwp2	A	G	10: 78,183,006	Y56H	probably benign	Het
Rarb	G	A	14: 16,432,085		probably benign	Het
Rpain	C	G	11: 70,970,921	H50Q	probably benign	Het
Rps9	CTGTTTG	CTG	7: 3,704,759		probably null	Het
Rubcn	A	T	16: 32,843,193	S358T	probably damaging	Het
Ryr2	G	A	13: 11,742,011	R1586C	probably damaging	Het
Slfn9	T	C	11: 82,981,904	I669V	probably benign	Het
Slx1b	T	C	7: 126,691,767		probably benign	Het
Spsb3	T	A	17: 24,887,511		probably benign	Het
Tbx15	A	G	3: 99,326,384	I288V	possibly damaging	Het
Trim17	A	T	11: 58,970,428	D253V	probably damaging	Het
Trim69	A	G	2: 122,178,746	D429G	probably damaging	Het
Vstm5	A	G	9: 15,257,794		probably null	Het
Vwa3b	A	G	1: 37,085,332	Q337R	probably benign	Het
Zfp113	T	C	5: 138,145,472	N172S	probably benign	Het
Zfp607a	T	A	7: 27,878,751	H415Q	probably damaging	Het
Zfp87	G	A	13: 67,517,899	T148I	probably benign	Het

Other mutations in Tlr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01762:Tlr2	APN	3	83836994	missense	probably benign
IGL02160:Tlr2	APN	3	83837371	missense	possibly damaging	0.47
IGL02405:Tlr2	APN	3	83836674	missense	probably damaging	1.00
IGL02940:Tlr2	APN	3	83836474	missense	probably benign	0.03
IGL03165:Tlr2	APN	3	83837948	missense	probably benign	0.00
languid	UTSW	3	83837315	missense	probably damaging	1.00
G1patch:Tlr2	UTSW	3	83838296	missense	probably benign
PIT4131001:Tlr2	UTSW	3	83838449	missense	probably benign	0.34
R1177:Tlr2	UTSW	3	83838734	missense	probably benign	0.02
R1251:Tlr2	UTSW	3	83838269	missense	possibly damaging	0.64
R1346:Tlr2	UTSW	3	83836593	missense	probably damaging	0.99
R1553:Tlr2	UTSW	3	83837463	missense	probably benign
R1613:Tlr2	UTSW	3	83837353	missense	probably damaging	1.00
R1816:Tlr2	UTSW	3	83838209	missense	probably damaging	1.00
R2312:Tlr2	UTSW	3	83837540	missense	probably damaging	1.00
R3023:Tlr2	UTSW	3	83837871	missense	probably benign
R4724:Tlr2	UTSW	3	83838185	missense	probably damaging	1.00
R5109:Tlr2	UTSW	3	83837723	missense	probably damaging	1.00
R5764:Tlr2	UTSW	3	83838512	missense	probably damaging	1.00
R5859:Tlr2	UTSW	3	83836503	missense	possibly damaging	0.94
R6169:Tlr2	UTSW	3	83838148	missense	probably benign
R6236:Tlr2	UTSW	3	83838131	missense	probably benign
R6384:Tlr2	UTSW	3	83836994	missense	probably benign
R6564:Tlr2	UTSW	3	83837695	missense	probably benign	0.05
R6725:Tlr2	UTSW	3	83838296	missense	probably benign
R7032:Tlr2	UTSW	3	83837905	missense	probably benign	0.01
R7256:Tlr2	UTSW	3	83837606	missense	possibly damaging	0.93
R7571:Tlr2	UTSW	3	83836542	missense	probably damaging	1.00
R7970:Tlr2	UTSW	3	83837894	missense	probably benign	0.01
R8191:Tlr2	UTSW	3	83836514	missense	probably damaging	1.00
R8191:Tlr2	UTSW	3	83836515	missense	probably damaging	0.99
R8217:Tlr2	UTSW	3	83838066	missense	probably benign	0.17
R8218:Tlr2	UTSW	3	83838239	missense	probably damaging	1.00
R8834:Tlr2	UTSW	3	83838713	missense	probably benign
R8894:Tlr2	UTSW	3	83836784	missense	probably damaging	1.00
R8922:Tlr2	UTSW	3	83837768	missense	probably benign	0.02
Z1177:Tlr2	UTSW	3	83836607	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGCGTCTCCATAGTAAAGG -3'
(R):5'- CCTCTCTTGACATCAGCAGG -3'

Sequencing Primer
(F):5'- CTCCATAGTAAAGGATAGGAGTTCGC -3'
(R):5'- GCAGGAACACTTTTCATCCGATG -3'

Posted On

2016-04-27