Incidental Mutation 'R4950:Tlr2'
List |< first << previous [record 46 of 53] next >> last >|
ID381903
Institutional Source Beutler Lab
Gene Symbol Tlr2
Ensembl Gene ENSMUSG00000027995
Gene Nametoll-like receptor 2
SynonymsLy105
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83836272-83841767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83837332 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 481 (E481D)
Ref Sequence ENSEMBL: ENSMUSP00000029623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029623]
Predicted Effect probably damaging
Transcript: ENSMUST00000029623
AA Change: E481D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029623
Gene: ENSMUSG00000027995
AA Change: E481D

DomainStartEndE-ValueType
LRR 51 74 1.45e2 SMART
LRR 75 98 2.33e2 SMART
LRR_TYP 99 122 3.69e-4 SMART
low complexity region 268 281 N/A INTRINSIC
LRR 359 384 6.78e1 SMART
LRR 386 409 2.54e2 SMART
LRR 412 435 8.49e1 SMART
LRR_TYP 476 499 3.34e-2 SMART
LRRCT 533 586 5.04e-7 SMART
transmembrane domain 588 610 N/A INTRINSIC
TIR 640 784 5.08e-38 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice demonstrate abnormal responses to bacterial and viral infections. Mice homozygous for a knock-out allele also exhibit disruption in circadian active and inactive state consolidation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Tlr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Tlr2 APN 3 83836994 missense probably benign
IGL02160:Tlr2 APN 3 83837371 missense possibly damaging 0.47
IGL02405:Tlr2 APN 3 83836674 missense probably damaging 1.00
IGL02940:Tlr2 APN 3 83836474 missense probably benign 0.03
IGL03165:Tlr2 APN 3 83837948 missense probably benign 0.00
languid UTSW 3 83837315 missense probably damaging 1.00
PIT4131001:Tlr2 UTSW 3 83838449 missense probably benign 0.34
R1177:Tlr2 UTSW 3 83838734 missense probably benign 0.02
R1251:Tlr2 UTSW 3 83838269 missense possibly damaging 0.64
R1346:Tlr2 UTSW 3 83836593 missense probably damaging 0.99
R1553:Tlr2 UTSW 3 83837463 missense probably benign
R1613:Tlr2 UTSW 3 83837353 missense probably damaging 1.00
R1816:Tlr2 UTSW 3 83838209 missense probably damaging 1.00
R2312:Tlr2 UTSW 3 83837540 missense probably damaging 1.00
R3023:Tlr2 UTSW 3 83837871 missense probably benign
R4724:Tlr2 UTSW 3 83838185 missense probably damaging 1.00
R5109:Tlr2 UTSW 3 83837723 missense probably damaging 1.00
R5764:Tlr2 UTSW 3 83838512 missense probably damaging 1.00
R5859:Tlr2 UTSW 3 83836503 missense possibly damaging 0.94
R6169:Tlr2 UTSW 3 83838148 missense probably benign
R6236:Tlr2 UTSW 3 83838131 missense probably benign
R6384:Tlr2 UTSW 3 83836994 missense probably benign
R6564:Tlr2 UTSW 3 83837695 missense probably benign 0.05
R6725:Tlr2 UTSW 3 83838296 missense probably benign
R7032:Tlr2 UTSW 3 83837905 missense probably benign 0.01
R7256:Tlr2 UTSW 3 83837606 missense possibly damaging 0.93
R7571:Tlr2 UTSW 3 83836542 missense probably damaging 1.00
R7970:Tlr2 UTSW 3 83837894 missense probably benign 0.01
R8191:Tlr2 UTSW 3 83836514 missense probably damaging 1.00
R8191:Tlr2 UTSW 3 83836515 missense probably damaging 0.99
R8217:Tlr2 UTSW 3 83838066 missense probably benign 0.17
R8218:Tlr2 UTSW 3 83838239 missense probably damaging 1.00
Z1177:Tlr2 UTSW 3 83836607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCGTCTCCATAGTAAAGG -3'
(R):5'- CCTCTCTTGACATCAGCAGG -3'

Sequencing Primer
(F):5'- CTCCATAGTAAAGGATAGGAGTTCGC -3'
(R):5'- GCAGGAACACTTTTCATCCGATG -3'
Posted On2016-04-27