Incidental Mutation 'R4950:Ntrk1'
ID381904
Institutional Source Beutler Lab
Gene Symbol Ntrk1
Ensembl Gene ENSMUSG00000028072
Gene Nameneurotrophic tyrosine kinase, receptor, type 1
SynonymsTkr, TrkA
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4950 (G1)
Quality Score223
Status Validated
Chromosome3
Chromosomal Location87778244-87795162 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 87789611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029712] [ENSMUST00000029714] [ENSMUST00000090981]
Predicted Effect probably null
Transcript: ENSMUST00000029712
SMART Domains Protein: ENSMUSP00000029712
Gene: ENSMUSG00000028072

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LRR_8 91 150 8.9e-14 PFAM
Pfam:TPKR_C2 151 194 4.9e-15 PFAM
IG 202 285 3.2e-2 SMART
low complexity region 419 442 N/A INTRINSIC
TyrKc 513 784 2.31e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine kinase receptor (NTKR) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. The presence of this kinase leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in this gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. Alternate transcriptional splice variants of this gene have been found, but only three have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations result in premature death due to severe sensory and sympathetic neuropathies. A conditional mutant mouse exhibits defects in mast cell and B cell physiology. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Ntrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ntrk1 APN 3 87791438 missense possibly damaging 0.94
IGL00756:Ntrk1 APN 3 87783697 missense probably benign 0.05
IGL01340:Ntrk1 APN 3 87788714 missense possibly damaging 0.72
IGL02262:Ntrk1 APN 3 87781797 missense probably damaging 1.00
IGL02268:Ntrk1 APN 3 87781531 missense probably damaging 1.00
IGL02290:Ntrk1 APN 3 87781771 missense probably benign 0.11
IGL02435:Ntrk1 APN 3 87788732 missense probably benign 0.01
IGL03007:Ntrk1 APN 3 87782743 missense possibly damaging 0.56
PIT4802001:Ntrk1 UTSW 3 87788634 missense probably damaging 0.98
R0015:Ntrk1 UTSW 3 87791750 intron probably benign
R0140:Ntrk1 UTSW 3 87778568 missense probably damaging 1.00
R0269:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R0457:Ntrk1 UTSW 3 87791707 missense probably benign
R0617:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R1144:Ntrk1 UTSW 3 87781542 missense probably damaging 1.00
R1152:Ntrk1 UTSW 3 87778593 missense probably benign 0.33
R1439:Ntrk1 UTSW 3 87789611 splice site probably null
R1588:Ntrk1 UTSW 3 87780077 nonsense probably null
R1764:Ntrk1 UTSW 3 87780084 missense probably damaging 0.99
R1766:Ntrk1 UTSW 3 87778518 missense probably damaging 1.00
R1771:Ntrk1 UTSW 3 87789630 missense probably benign
R2264:Ntrk1 UTSW 3 87779634 critical splice donor site probably null
R2377:Ntrk1 UTSW 3 87791407 missense possibly damaging 0.70
R4059:Ntrk1 UTSW 3 87781479 missense probably damaging 1.00
R5107:Ntrk1 UTSW 3 87794973 missense probably benign 0.01
R5805:Ntrk1 UTSW 3 87780172 missense probably damaging 1.00
R6073:Ntrk1 UTSW 3 87791370 splice site probably null
R6372:Ntrk1 UTSW 3 87786048 missense probably benign
R6894:Ntrk1 UTSW 3 87782802 missense probably damaging 1.00
R6972:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
R6973:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
R7309:Ntrk1 UTSW 3 87795077 missense probably benign 0.00
R7693:Ntrk1 UTSW 3 87788426 missense probably benign
R7836:Ntrk1 UTSW 3 87779734 nonsense probably null
R8311:Ntrk1 UTSW 3 87781563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTCCTGCAGGCTCTACTTG -3'
(R):5'- CGTAGCACGATGTTCAAGTTGAC -3'

Sequencing Primer
(F):5'- GCTGACAGGCATGCACATAATTG -3'
(R):5'- CAAGTTGACTTGCCTGGGGAC -3'
Posted On2016-04-27