Incidental Mutation 'R4950:Mcoln3'
List |< first << previous [record 23 of 53] next >> last >|
ID381906
Institutional Source Beutler Lab
Gene Symbol Mcoln3
Ensembl Gene ENSMUSG00000036853
Gene Namemucolipin 3
Synonymsvaritint-waddler, Va, 6720490O21Rik, TRPML3
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146117450-146141806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146139519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 490 (I490T)
Ref Sequence ENSEMBL: ENSMUSP00000038801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039450]
Predicted Effect probably damaging
Transcript: ENSMUST00000039450
AA Change: I490T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038801
Gene: ENSMUSG00000036853
AA Change: I490T

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Pfam:PKD_channel 360 508 3.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146689
Meta Mutation Damage Score 0.2108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Heterozygotes show normal/diluted/white hair patches, circling, hyperactivity, deafness, and reduced fertility. Homozygotes are white with small patches of color and show severe behavioral abnormalities, poor postnatal viability and are nearly infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Mcoln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mcoln3 APN 3 146133928 missense probably damaging 1.00
IGL01106:Mcoln3 APN 3 146137264 missense probably benign 0.01
IGL01712:Mcoln3 APN 3 146128264 unclassified probably benign
IGL02115:Mcoln3 APN 3 146137301 missense probably damaging 0.99
IGL02116:Mcoln3 APN 3 146133909 missense probably benign 0.29
P4717OSA:Mcoln3 UTSW 3 146124749 missense probably damaging 0.99
R0463:Mcoln3 UTSW 3 146140576 nonsense probably null
R1981:Mcoln3 UTSW 3 146140590 nonsense probably null
R2056:Mcoln3 UTSW 3 146128224 missense probably benign 0.01
R3000:Mcoln3 UTSW 3 146133907 missense possibly damaging 0.62
R4366:Mcoln3 UTSW 3 146140492 missense possibly damaging 0.76
R4667:Mcoln3 UTSW 3 146131204 missense probably benign 0.01
R5457:Mcoln3 UTSW 3 146128122 missense probably benign 0.00
R6302:Mcoln3 UTSW 3 146124772 missense probably benign 0.00
R6353:Mcoln3 UTSW 3 146131154 missense probably damaging 0.99
R6632:Mcoln3 UTSW 3 146128187 missense probably benign
R6915:Mcoln3 UTSW 3 146137256 critical splice acceptor site probably null
R7790:Mcoln3 UTSW 3 146139492 missense probably damaging 1.00
R7838:Mcoln3 UTSW 3 146139475 missense probably damaging 1.00
R7861:Mcoln3 UTSW 3 146124791 missense possibly damaging 0.95
R8509:Mcoln3 UTSW 3 146124892 missense probably benign 0.00
Z1176:Mcoln3 UTSW 3 146140466 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGTCAGGATGCTGTCATG -3'
(R):5'- GACGCTCATCATTCTAGAAATTCC -3'

Sequencing Primer
(F):5'- GGATGCTGTCATGAACAAAAATCTCC -3'
(R):5'- ATTCTAGAAATTCCATTCTCCTTCAC -3'
Posted On2016-04-27