Mutagenetix > Incidental Mutation

Incidental Mutation 'R4950:Disp3'

381909

Institutional Source

Beutler Lab

Gene Symbol

Disp3

Ensembl Gene

ENSMUSG00000041544

Gene Name

dispatched RND transporter family member 3

Synonyms

Ptchd2, G630052C06Rik

MMRRC Submission

042547-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4950 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148240264-148287965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 148258126 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 622 (D622E)

Ref Sequence

ENSEMBL: ENSMUSP00000038490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047720]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047720
AA Change: D622E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: D622E

Domain	Start	End	E-Value	Type
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	159	171	N/A	INTRINSIC
low complexity region	179	195	N/A	INTRINSIC
Pfam:Patched	362	735	2.2e-21	PFAM
Pfam:MMPL	366	590	3.1e-14	PFAM
Pfam:Sterol-sensing	435	588	1.1e-17	PFAM
Pfam:Patched	1121	1301	1.6e-7	PFAM
transmembrane domain	1314	1333	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143851

Meta Mutation Damage Score

0.0918

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 92.9%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	T	2: 154,311,659	D215V	probably damaging	Het
Cacna1i	A	G	15: 80,368,671	E625G	probably damaging	Het
Cage1	C	T	13: 38,023,326	S181N	possibly damaging	Het
Ccdc36	A	C	9: 108,421,510	S36R	probably damaging	Het
Ccdc73	A	C	2: 104,992,366	I887L	probably benign	Het
Cfap65	T	A	1: 74,906,336	K1408*	probably null	Het
Cngb1	C	A	8: 95,248,507	G654W	probably damaging	Het
Cxcl15	A	T	5: 90,795,245	E35D	possibly damaging	Het
Ddi1	A	G	9: 6,266,073	S99P	probably benign	Het
Dnajc22	G	A	15: 99,101,734	V267I	probably benign	Het
Dph5	G	A	3: 115,928,643	G257S	probably benign	Het
Elmo2	A	T	2: 165,314,813		probably null	Het
Fam186a	T	C	15: 99,941,653	R2237G	unknown	Het
Fez1	G	A	9: 36,867,882	R285Q	probably damaging	Het
Fsip2	A	T	2: 82,946,932	H101L	probably damaging	Het
Fsip2	G	A	2: 82,977,414	C1359Y	probably benign	Het
Fxyd7	G	A	7: 31,047,390	T15I	probably benign	Het
Gpr155	A	T	2: 73,382,185	D31E	probably benign	Het
Irx6	A	T	8: 92,678,800	Y432F	probably damaging	Het
Itih5	A	C	2: 10,235,081	I340L	probably damaging	Het
Lao1	T	C	4: 118,965,375	L164S	probably damaging	Het
Mcoln3	T	C	3: 146,139,519	I490T	probably damaging	Het
Mef2b	T	C	8: 70,167,196	Y311H	probably damaging	Het
Mras	A	T	9: 99,394,484	L111Q	probably damaging	Het
Mrc1	A	G	2: 14,271,280	D475G	probably damaging	Het
Nrcam	T	C	12: 44,598,490	I1155T	probably damaging	Het
Ntrk1	A	G	3: 87,789,611		probably null	Het
Olfr58	G	A	9: 19,783,731	M199I	probably benign	Het
Olfr885	T	C	9: 38,062,001	I227T	probably damaging	Het
Parp9	A	T	16: 35,948,007	I186F	probably damaging	Het
Pcdhac2	T	A	18: 37,145,230	V421E	probably benign	Het
Pck1	T	A	2: 173,154,827	I178K	probably benign	Het
Pde6b	A	G	5: 108,430,703	K836E	probably benign	Het
Ptprd	T	A	4: 76,140,515		probably null	Het
Pwp2	A	G	10: 78,183,006	Y56H	probably benign	Het
Rarb	G	A	14: 16,432,085		probably benign	Het
Rpain	C	G	11: 70,970,921	H50Q	probably benign	Het
Rps9	CTGTTTG	CTG	7: 3,704,759		probably null	Het
Rubcn	A	T	16: 32,843,193	S358T	probably damaging	Het
Ryr2	G	A	13: 11,742,011	R1586C	probably damaging	Het
Slfn9	T	C	11: 82,981,904	I669V	probably benign	Het
Slx1b	T	C	7: 126,691,767		probably benign	Het
Spsb3	T	A	17: 24,887,511		probably benign	Het
Tbx15	A	G	3: 99,326,384	I288V	possibly damaging	Het
Tlr2	C	A	3: 83,837,332	E481D	probably damaging	Het
Trim17	A	T	11: 58,970,428	D253V	probably damaging	Het
Trim69	A	G	2: 122,178,746	D429G	probably damaging	Het
Vstm5	A	G	9: 15,257,794		probably null	Het
Vwa3b	A	G	1: 37,085,332	Q337R	probably benign	Het
Zfp113	T	C	5: 138,145,472	N172S	probably benign	Het
Zfp607a	T	A	7: 27,878,751	H415Q	probably damaging	Het
Zfp87	G	A	13: 67,517,899	T148I	probably benign	Het

Other mutations in Disp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Disp3	APN	4	148241534	missense	probably benign	0.10
IGL01065:Disp3	APN	4	148261183	missense	probably damaging	1.00
IGL01800:Disp3	APN	4	148249801	nonsense	probably null
IGL01947:Disp3	APN	4	148260519	missense	probably damaging	1.00
IGL02510:Disp3	APN	4	148252701	missense	probably benign	0.00
IGL02573:Disp3	APN	4	148271449	missense	probably damaging	1.00
IGL02728:Disp3	APN	4	148272038	missense	probably damaging	1.00
IGL02931:Disp3	APN	4	148249201	missense	possibly damaging	0.94
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0257:Disp3	UTSW	4	148250754	missense	possibly damaging	0.87
R0409:Disp3	UTSW	4	148271959	missense	probably damaging	1.00
R0557:Disp3	UTSW	4	148241404	missense	possibly damaging	0.64
R0576:Disp3	UTSW	4	148241590	missense	possibly damaging	0.89
R1495:Disp3	UTSW	4	148249825	missense	probably benign	0.00
R1526:Disp3	UTSW	4	148259916	missense	probably benign	0.00
R1791:Disp3	UTSW	4	148241518	missense	probably damaging	1.00
R1856:Disp3	UTSW	4	148271632	missense	probably damaging	1.00
R1987:Disp3	UTSW	4	148258753	missense	probably damaging	0.97
R2030:Disp3	UTSW	4	148259966	missense	probably damaging	1.00
R2271:Disp3	UTSW	4	148271602	missense	possibly damaging	0.87
R2373:Disp3	UTSW	4	148258795	missense	probably damaging	1.00
R2566:Disp3	UTSW	4	148241423	missense	probably damaging	1.00
R3731:Disp3	UTSW	4	148252827	missense	probably benign	0.03
R4359:Disp3	UTSW	4	148271932	missense	probably benign	0.03
R4762:Disp3	UTSW	4	148272118	missense	probably damaging	1.00
R4975:Disp3	UTSW	4	148244216	missense	possibly damaging	0.79
R5218:Disp3	UTSW	4	148242876	missense	possibly damaging	0.88
R5523:Disp3	UTSW	4	148258097	missense	probably benign	0.14
R5556:Disp3	UTSW	4	148258157	missense	probably benign	0.14
R5857:Disp3	UTSW	4	148249183	missense	probably benign	0.01
R5933:Disp3	UTSW	4	148241313	nonsense	probably null
R5994:Disp3	UTSW	4	148254284	missense	possibly damaging	0.94
R6362:Disp3	UTSW	4	148254308	missense	possibly damaging	0.95
R6813:Disp3	UTSW	4	148259930	missense	probably benign	0.09
R7211:Disp3	UTSW	4	148241522	missense	probably damaging	0.98
R7470:Disp3	UTSW	4	148261070	missense	possibly damaging	0.88
R7535:Disp3	UTSW	4	148242866	missense	probably damaging	0.99
R8093:Disp3	UTSW	4	148270516	missense	possibly damaging	0.93
R8357:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8457:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8506:Disp3	UTSW	4	148241570	missense	possibly damaging	0.77
R9182:Disp3	UTSW	4	148270384	missense	probably damaging	1.00
R9219:Disp3	UTSW	4	148249860	missense	possibly damaging	0.74
R9680:Disp3	UTSW	4	148271644	missense	probably damaging	1.00
R9696:Disp3	UTSW	4	148261154	missense	probably damaging	0.97
Z1088:Disp3	UTSW	4	148271743	missense	possibly damaging	0.63
Z1176:Disp3	UTSW	4	148250957	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249746	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249847	missense	probably benign	0.01
Z1177:Disp3	UTSW	4	148250714	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148270567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTCAGAGTCTGAGCCACAG -3'
(R):5'- TCATCATAGTCACTGGTGCCTC -3'

Sequencing Primer
(F):5'- AGTCTGAGCCACAGCCTGC -3'
(R):5'- ACTGGTGCCTCTCCTGCAAG -3'

Posted On

2016-04-27