Incidental Mutation 'R4950:Rps9'
ID 381913
Institutional Source Beutler Lab
Gene Symbol Rps9
Ensembl Gene ENSMUSG00000006333
Gene Name ribosomal protein S9
Synonyms 3010033P07Rik
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R4950 (G1)
Quality Score 217
Status Validated
Chromosome 7
Chromosomal Location 3707035-3709896 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CTGTTTG to CTG at 3707758 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006496] [ENSMUST00000038521] [ENSMUST00000108623] [ENSMUST00000108624] [ENSMUST00000108625] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000126562] [ENSMUST00000146927] [ENSMUST00000205287] [ENSMUST00000139818] [ENSMUST00000155060]
AlphaFold Q6ZWN5
Predicted Effect probably null
Transcript: ENSMUST00000006496
SMART Domains Protein: ENSMUSP00000006496
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 1.1e-33 PFAM
S4 108 179 6.84e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038521
SMART Domains Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 219 303 2.9e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108623
SMART Domains Protein: ENSMUSP00000104263
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 6.7e-34 PFAM
Pfam:S4 108 137 2.8e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108624
SMART Domains Protein: ENSMUSP00000104264
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 78 4.6e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108625
SMART Domains Protein: ENSMUSP00000104265
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Ribosomal_S4 3 107 3.47e-16 SMART
S4 108 179 6.84e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108627
SMART Domains Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108629
SMART Domains Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 256 3.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108630
SMART Domains Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 7.9e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126562
SMART Domains Protein: ENSMUSP00000120736
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 1.3e-33 PFAM
Pfam:S4 108 136 2.8e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146927
SMART Domains Protein: ENSMUSP00000116623
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 2 103 1.3e-33 PFAM
Pfam:S4 104 133 2.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136858
Predicted Effect probably benign
Transcript: ENSMUST00000147288
Predicted Effect probably benign
Transcript: ENSMUST00000205287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128729
Predicted Effect probably benign
Transcript: ENSMUST00000139818
SMART Domains Protein: ENSMUSP00000114894
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 58 2.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155060
SMART Domains Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S4P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, multiple processed pseudogenes derived from this gene are dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Elmo2 A T 2: 165,156,733 (GRCm39) probably null Het
Fam186a T C 15: 99,839,534 (GRCm39) R2237G unknown Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Or8b38 T C 9: 37,973,297 (GRCm39) I227T probably damaging Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Pwp2 A G 10: 78,018,840 (GRCm39) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rubcn A T 16: 32,663,563 (GRCm39) S358T probably damaging Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Slx1b T C 7: 126,290,939 (GRCm39) probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tbx15 A G 3: 99,233,700 (GRCm39) I288V possibly damaging Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Rps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1809:Rps9 UTSW 7 3,707,726 (GRCm39) missense probably damaging 1.00
R3839:Rps9 UTSW 7 3,709,823 (GRCm39) utr 3 prime probably benign
R6826:Rps9 UTSW 7 3,708,775 (GRCm39) missense probably benign 0.00
Z1177:Rps9 UTSW 7 3,709,727 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGATGTCTGTCTCCCACGTG -3'
(R):5'- TTGTGACACATACCCAGCAC -3'

Sequencing Primer
(F):5'- CTCTAGTCGCCATGCACATGTAG -3'
(R):5'- AGCACTTCTGAATTTCTGGCAG -3'
Posted On 2016-04-27