Incidental Mutation 'R4950:Rps9'
List |< first << previous [record 39 of 53] next >> last >|
ID381913
Institutional Source Beutler Lab
Gene Symbol Rps9
Ensembl Gene ENSMUSG00000006333
Gene Nameribosomal protein S9
Synonyms
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4950 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location3703993-3706897 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTGTTTG to CTG at 3704759 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006496] [ENSMUST00000038521] [ENSMUST00000108623] [ENSMUST00000108624] [ENSMUST00000108625] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000126562] [ENSMUST00000139818] [ENSMUST00000146927] [ENSMUST00000205287] [ENSMUST00000155060]
Predicted Effect probably null
Transcript: ENSMUST00000006496
SMART Domains Protein: ENSMUSP00000006496
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 1.1e-33 PFAM
S4 108 179 6.84e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038521
SMART Domains Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 219 303 2.9e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108623
SMART Domains Protein: ENSMUSP00000104263
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 6.7e-34 PFAM
Pfam:S4 108 137 2.8e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108624
SMART Domains Protein: ENSMUSP00000104264
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 78 4.6e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108625
SMART Domains Protein: ENSMUSP00000104265
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Ribosomal_S4 3 107 3.47e-16 SMART
S4 108 179 6.84e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108627
SMART Domains Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108629
SMART Domains Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 256 3.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108630
SMART Domains Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 7.9e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126562
SMART Domains Protein: ENSMUSP00000120736
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 1.3e-33 PFAM
Pfam:S4 108 136 2.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136858
Predicted Effect probably benign
Transcript: ENSMUST00000139818
SMART Domains Protein: ENSMUSP00000114894
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 58 2.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146927
SMART Domains Protein: ENSMUSP00000116623
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 2 103 1.3e-33 PFAM
Pfam:S4 104 133 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147288
Predicted Effect probably benign
Transcript: ENSMUST00000205287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146303
Predicted Effect probably benign
Transcript: ENSMUST00000155060
SMART Domains Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S4P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, multiple processed pseudogenes derived from this gene are dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Rps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1809:Rps9 UTSW 7 3704727 missense probably damaging 1.00
R3839:Rps9 UTSW 7 3706824 utr 3 prime probably benign
R6826:Rps9 UTSW 7 3705776 missense probably benign 0.00
Z1177:Rps9 UTSW 7 3706728 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGATGTCTGTCTCCCACGTG -3'
(R):5'- TTGTGACACATACCCAGCAC -3'

Sequencing Primer
(F):5'- CTCTAGTCGCCATGCACATGTAG -3'
(R):5'- AGCACTTCTGAATTTCTGGCAG -3'
Posted On2016-04-27