Incidental Mutation 'R4950:Zfp607a'
ID381915
Institutional Source Beutler Lab
Gene Symbol Zfp607a
Ensembl Gene ENSMUSG00000020420
Gene Namezinc finger protein 607A
SynonymsZfp607, 4732475C15Rik
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27857527-27880825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27878751 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 415 (H415Q)
Ref Sequence ENSEMBL: ENSMUSP00000146006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053722] [ENSMUST00000205534] [ENSMUST00000205715]
Predicted Effect probably damaging
Transcript: ENSMUST00000053722
AA Change: H415Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051496
Gene: ENSMUSG00000020420
AA Change: H415Q

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.91e-2 SMART
ZnF_C2H2 201 223 3.44e-4 SMART
ZnF_C2H2 229 251 3.83e-2 SMART
ZnF_C2H2 257 279 4.87e-4 SMART
ZnF_C2H2 285 307 1.38e-3 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 2.86e-1 SMART
ZnF_C2H2 369 391 5.14e-3 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 4.47e-3 SMART
ZnF_C2H2 453 475 1.1e-2 SMART
ZnF_C2H2 481 503 1.45e-2 SMART
ZnF_C2H2 509 531 1.12e-3 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 8.34e-3 SMART
ZnF_C2H2 593 615 1.12e-3 SMART
ZnF_C2H2 621 643 6.42e-4 SMART
ZnF_C2H2 649 671 6.23e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205534
AA Change: H415Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000205715
AA Change: H415Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206136
Meta Mutation Damage Score 0.2940 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Zfp607a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Zfp607a APN 7 27877789 missense possibly damaging 0.55
IGL01019:Zfp607a APN 7 27878617 missense probably damaging 1.00
IGL01412:Zfp607a APN 7 27878684 missense probably damaging 0.99
IGL03206:Zfp607a APN 7 27877823 missense possibly damaging 0.52
R0071:Zfp607a UTSW 7 27878269 missense probably damaging 0.96
R0304:Zfp607a UTSW 7 27879212 missense possibly damaging 0.92
R0685:Zfp607a UTSW 7 27878476 missense probably damaging 0.97
R0726:Zfp607a UTSW 7 27879149 missense probably benign 0.00
R1201:Zfp607a UTSW 7 27879311 missense probably damaging 1.00
R1304:Zfp607a UTSW 7 27865575 missense probably benign 0.00
R1648:Zfp607a UTSW 7 27879068 missense probably benign 0.02
R1732:Zfp607a UTSW 7 27878459 missense probably damaging 1.00
R2194:Zfp607a UTSW 7 27879380 missense possibly damaging 0.73
R3793:Zfp607a UTSW 7 27878906 missense probably benign 0.01
R3808:Zfp607a UTSW 7 27879401 missense probably benign 0.01
R4296:Zfp607a UTSW 7 27865648 missense probably damaging 1.00
R4786:Zfp607a UTSW 7 27879413 missense probably damaging 1.00
R4792:Zfp607a UTSW 7 27878653 missense probably benign 0.23
R4915:Zfp607a UTSW 7 27878560 missense probably benign 0.00
R5123:Zfp607a UTSW 7 27879098 missense probably damaging 1.00
R5217:Zfp607a UTSW 7 27877844 missense probably damaging 0.97
R5270:Zfp607a UTSW 7 27878305 nonsense probably null
R5403:Zfp607a UTSW 7 27879319 missense possibly damaging 0.54
R6010:Zfp607a UTSW 7 27877829 nonsense probably null
R6224:Zfp607a UTSW 7 27878582 missense probably damaging 1.00
R6939:Zfp607a UTSW 7 27879048 nonsense probably null
R6953:Zfp607a UTSW 7 27878365 missense possibly damaging 0.59
R7082:Zfp607a UTSW 7 27878758 missense probably damaging 1.00
R7781:Zfp607a UTSW 7 27865575 missense possibly damaging 0.90
R7909:Zfp607a UTSW 7 27879094 missense probably damaging 1.00
R8191:Zfp607a UTSW 7 27879443 missense possibly damaging 0.93
R8224:Zfp607a UTSW 7 27878111 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGCACCAGAGTATTCATAC -3'
(R):5'- ACTGGGAAGATGAAAAGCCTTTC -3'

Sequencing Primer
(F):5'- CCAATGAGAAGCCCTTTGAATG -3'
(R):5'- CACCACTGTGAGATTTCTGATG -3'
Posted On2016-04-27