Incidental Mutation 'R4950:Slx1b'
ID381918
Institutional Source Beutler Lab
Gene Symbol Slx1b
Ensembl Gene ENSMUSG00000059772
Gene NameSLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)
Synonyms4833422P03Rik, Giyd2, 1110030E23Rik, 2410170E21Rik
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4950 (G1)
Quality Score138
Status Validated
Chromosome7
Chromosomal Location126689468-126695784 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 126691767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000142337] [ENSMUST00000144897]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084586
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122029
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142337
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Predicted Effect unknown
Transcript: ENSMUST00000144897
AA Change: E252G
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772
AA Change: E252G

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit mouse embryonic fibroblasts that are more sensitive to DNA interstrand corsslinking agents with increased cell death, chromatide breaks, radial structures and impaired resolution of Holliday junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Slx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0437:Slx1b UTSW 7 126692581 missense probably benign 0.02
R0601:Slx1b UTSW 7 126692640 missense probably damaging 1.00
R0714:Slx1b UTSW 7 126692448 missense probably damaging 0.98
R1457:Slx1b UTSW 7 126692796 missense probably damaging 0.98
R3975:Slx1b UTSW 7 126691807 missense probably damaging 1.00
R4757:Slx1b UTSW 7 126692529 missense probably benign
R6194:Slx1b UTSW 7 126692331 missense possibly damaging 0.80
R7334:Slx1b UTSW 7 126692527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGGTACCCTTATCCCAGC -3'
(R):5'- GACATTGTCCTAGGTGAGTCC -3'

Sequencing Primer
(F):5'- GCTCAAGTAAAAGCTGCCAGTTACTG -3'
(R):5'- AGGTGAGTCCTAGTCCTCTTC -3'
Posted On2016-04-27