Incidental Mutation 'R4950:Slx1b'
ID 381918
Institutional Source Beutler Lab
Gene Symbol Slx1b
Ensembl Gene ENSMUSG00000059772
Gene Name SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)
Synonyms 2410170E21Rik, 4833422P03Rik, Giyd2, 1110030E23Rik
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4950 (G1)
Quality Score 138
Status Validated
Chromosome 7
Chromosomal Location 126288640-126294956 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to C at 126290939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000142337] [ENSMUST00000144897]
AlphaFold Q8BX32
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084586
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122029
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142337
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Predicted Effect unknown
Transcript: ENSMUST00000144897
AA Change: E252G
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772
AA Change: E252G

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit mouse embryonic fibroblasts that are more sensitive to DNA interstrand corsslinking agents with increased cell death, chromatide breaks, radial structures and impaired resolution of Holliday junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Elmo2 A T 2: 165,156,733 (GRCm39) probably null Het
Fam186a T C 15: 99,839,534 (GRCm39) R2237G unknown Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Or8b38 T C 9: 37,973,297 (GRCm39) I227T probably damaging Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Pwp2 A G 10: 78,018,840 (GRCm39) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,707,758 (GRCm39) probably null Het
Rubcn A T 16: 32,663,563 (GRCm39) S358T probably damaging Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tbx15 A G 3: 99,233,700 (GRCm39) I288V possibly damaging Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Slx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0437:Slx1b UTSW 7 126,291,753 (GRCm39) missense probably benign 0.02
R0601:Slx1b UTSW 7 126,291,812 (GRCm39) missense probably damaging 1.00
R0714:Slx1b UTSW 7 126,291,620 (GRCm39) missense probably damaging 0.98
R1457:Slx1b UTSW 7 126,291,968 (GRCm39) missense probably damaging 0.98
R3975:Slx1b UTSW 7 126,290,979 (GRCm39) missense probably damaging 1.00
R4757:Slx1b UTSW 7 126,291,701 (GRCm39) missense probably benign
R6194:Slx1b UTSW 7 126,291,503 (GRCm39) missense possibly damaging 0.80
R7334:Slx1b UTSW 7 126,291,699 (GRCm39) missense probably damaging 0.99
R9664:Slx1b UTSW 7 126,291,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGTACCCTTATCCCAGC -3'
(R):5'- GACATTGTCCTAGGTGAGTCC -3'

Sequencing Primer
(F):5'- GCTCAAGTAAAAGCTGCCAGTTACTG -3'
(R):5'- AGGTGAGTCCTAGTCCTCTTC -3'
Posted On 2016-04-27