Incidental Mutation 'R4950:Mef2b'
List |< first << previous [record 24 of 53] next >> last >|
ID381919
Institutional Source Beutler Lab
Gene Symbol Mef2b
Ensembl Gene ENSMUSG00000079033
Gene Namemyocyte enhancer factor 2B
Synonyms
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70139711-70167488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70167196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 311 (Y311H)
Ref Sequence ENSEMBL: ENSMUSP00000105770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110140] [ENSMUST00000110141] [ENSMUST00000110143] [ENSMUST00000110146] [ENSMUST00000163756]
Predicted Effect probably benign
Transcript: ENSMUST00000110140
SMART Domains Protein: ENSMUSP00000105767
Gene: ENSMUSG00000079033

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110141
SMART Domains Protein: ENSMUSP00000105768
Gene: ENSMUSG00000079033

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110143
AA Change: Y311H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105770
Gene: ENSMUSG00000079033
AA Change: Y311H

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110146
AA Change: Y321H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105773
Gene: ENSMUSG00000079033
AA Change: Y321H

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163756
AA Change: Y321H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033
AA Change: Y321H

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Mef2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Mef2b UTSW 8 70164260 missense probably damaging 1.00
R1023:Mef2b UTSW 8 70165597 missense possibly damaging 0.82
R4091:Mef2b UTSW 8 70165102 missense probably damaging 1.00
R4162:Mef2b UTSW 8 70166311 missense probably damaging 1.00
R4562:Mef2b UTSW 8 70167268 missense probably damaging 1.00
R5318:Mef2b UTSW 8 70166843 missense probably damaging 0.99
R5752:Mef2b UTSW 8 70165617 missense possibly damaging 0.77
R6126:Mef2b UTSW 8 70166876 missense probably benign 0.01
R6279:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6300:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6332:Mef2b UTSW 8 70164139 splice site probably null
R6369:Mef2b UTSW 8 70165559 missense probably benign 0.05
R6873:Mef2b UTSW 8 70166307 missense probably benign 0.29
R7266:Mef2b UTSW 8 70164288 missense probably damaging 1.00
X0022:Mef2b UTSW 8 70166834 missense probably benign 0.41
Z1176:Mef2b UTSW 8 70166375 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAGAGAACCCCATGGCCTAC -3'
(R):5'- GCCTTAGTGATGCACAGTGG -3'

Sequencing Primer
(F):5'- ACAAGCCTTCTTACCTATCTTGTGGG -3'
(R):5'- ACAGTGGGTGCCCTCGTC -3'
Posted On2016-04-27