Incidental Mutation 'R4950:Olfr58'
List |< first << previous [record 29 of 53] next >> last >|
ID381924
Institutional Source Beutler Lab
Gene Symbol Olfr58
Ensembl Gene ENSMUSG00000058659
Gene Nameolfactory receptor 58
SynonymsIG6, MOR146-7P, MOR146-3, GA_x6K02T2PVTD-13523015-13523944
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19780283-19785333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19783731 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 199 (M199I)
Ref Sequence ENSEMBL: ENSMUSP00000150309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079660] [ENSMUST00000212363] [ENSMUST00000215112]
Predicted Effect probably benign
Transcript: ENSMUST00000079660
AA Change: M199I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078603
Gene: ENSMUSG00000063842
AA Change: M199I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 8.3e-8 PFAM
Pfam:7tm_1 41 290 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212363
Predicted Effect probably benign
Transcript: ENSMUST00000215112
AA Change: M199I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Olfr58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Olfr58 APN 9 19783949 splice site probably null
IGL01815:Olfr58 APN 9 19784015 missense probably damaging 1.00
IGL02408:Olfr58 APN 9 19783415 missense probably benign 0.31
IGL02644:Olfr58 APN 9 19783714 missense probably benign 0.30
IGL03243:Olfr58 APN 9 19783268 missense probably damaging 0.99
R0603:Olfr58 UTSW 9 19783939 missense probably damaging 1.00
R2363:Olfr58 UTSW 9 19783596 missense probably benign 0.00
R2570:Olfr58 UTSW 9 19784009 missense probably damaging 1.00
R3890:Olfr58 UTSW 9 19783715 missense probably benign 0.03
R3892:Olfr58 UTSW 9 19783715 missense probably benign 0.03
R4163:Olfr58 UTSW 9 19783790 missense possibly damaging 0.69
R4610:Olfr58 UTSW 9 19783146 nonsense probably null
R4691:Olfr58 UTSW 9 19783382 missense probably benign 0.33
R4707:Olfr58 UTSW 9 19783300 missense probably damaging 1.00
R4825:Olfr58 UTSW 9 19783576 missense possibly damaging 0.74
R5185:Olfr58 UTSW 9 19783376 missense probably damaging 1.00
R5202:Olfr58 UTSW 9 19783218 missense possibly damaging 0.46
R5439:Olfr58 UTSW 9 19783865 missense probably damaging 1.00
R5669:Olfr58 UTSW 9 19783757 missense probably benign 0.02
R5672:Olfr58 UTSW 9 19783211 missense possibly damaging 0.92
R6038:Olfr58 UTSW 9 19783562 missense probably benign
R6038:Olfr58 UTSW 9 19783562 missense probably benign
R6212:Olfr58 UTSW 9 19783289 missense probably damaging 1.00
R6415:Olfr58 UTSW 9 19783748 missense probably damaging 1.00
R7385:Olfr58 UTSW 9 19783211 missense possibly damaging 0.92
R7669:Olfr58 UTSW 9 19783543 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATGGGTGGCCATTTGTCACC -3'
(R):5'- GAGGTAAACTCCTATACCTGTTCC -3'

Sequencing Primer
(F):5'- AAGTCATTCTGAATCCTTGTCGG -3'
(R):5'- CCTATACCTGTTCCATAAAATAGGC -3'
Posted On2016-04-27