Incidental Mutation 'R4950:Olfr885'
ID 381926
Institutional Source Beutler Lab
Gene Symbol Olfr885
Ensembl Gene ENSMUSG00000096424
Gene Name olfactory receptor 885
Synonyms GA_x6K02T2PVTD-31740639-31741568, MOR162-12
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4950 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38061322-38062251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38062001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 227 (I227T)
Ref Sequence ENSEMBL: ENSMUSP00000080646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081985]
AlphaFold Q7TRE0
Predicted Effect probably damaging
Transcript: ENSMUST00000081985
AA Change: I227T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080646
Gene: ENSMUSG00000096424
AA Change: I227T

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 224 1.1e-5 PFAM
Pfam:7tm_1 41 288 7.5e-24 PFAM
Meta Mutation Damage Score 0.6221 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Olfr885
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Olfr885 APN 9 38062004 missense possibly damaging 0.58
IGL02441:Olfr885 APN 9 38061937 missense probably benign 0.02
IGL03263:Olfr885 APN 9 38061713 missense probably damaging 0.98
R1748:Olfr885 UTSW 9 38061500 missense probably damaging 1.00
R1870:Olfr885 UTSW 9 38061350 missense probably benign 0.24
R1920:Olfr885 UTSW 9 38061685 missense probably damaging 1.00
R1921:Olfr885 UTSW 9 38061685 missense probably damaging 1.00
R1922:Olfr885 UTSW 9 38061685 missense probably damaging 1.00
R4073:Olfr885 UTSW 9 38061869 missense probably damaging 1.00
R4727:Olfr885 UTSW 9 38062093 missense probably damaging 1.00
R4945:Olfr885 UTSW 9 38061772 missense probably damaging 1.00
R5116:Olfr885 UTSW 9 38061338 missense probably benign
R5233:Olfr885 UTSW 9 38062150 missense probably damaging 0.96
R5923:Olfr885 UTSW 9 38061858 missense probably benign 0.08
R6668:Olfr885 UTSW 9 38061770 missense possibly damaging 0.83
R8035:Olfr885 UTSW 9 38061665 missense probably damaging 0.99
R9392:Olfr885 UTSW 9 38061899 missense probably benign 0.01
R9481:Olfr885 UTSW 9 38061411 missense probably benign 0.01
RF020:Olfr885 UTSW 9 38061324 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- GTTTGCATGCTGAGACTCACC -3'
(R):5'- TTTCAGTGCAATGTGGACATC -3'

Sequencing Primer
(F):5'- ATGCTGAGACTCACCTTCTGTG -3'
(R):5'- CAGTGCAATGTGGACATCTTTATTCC -3'
Posted On 2016-04-27