Incidental Mutation 'R4950:Or8b38'
ID 381926
Institutional Source Beutler Lab
Gene Symbol Or8b38
Ensembl Gene ENSMUSG00000096424
Gene Name olfactory receptor family 8 subfamily B member 38
Synonyms MOR162-12, GA_x6K02T2PVTD-31740639-31741568, Olfr885
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4950 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 37972618-37973547 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37973297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 227 (I227T)
Ref Sequence ENSEMBL: ENSMUSP00000080646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081985]
AlphaFold Q7TRE0
Predicted Effect probably damaging
Transcript: ENSMUST00000081985
AA Change: I227T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080646
Gene: ENSMUSG00000096424
AA Change: I227T

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 224 1.1e-5 PFAM
Pfam:7tm_1 41 288 7.5e-24 PFAM
Meta Mutation Damage Score 0.6221 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Elmo2 A T 2: 165,156,733 (GRCm39) probably null Het
Fam186a T C 15: 99,839,534 (GRCm39) R2237G unknown Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Pwp2 A G 10: 78,018,840 (GRCm39) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,707,758 (GRCm39) probably null Het
Rubcn A T 16: 32,663,563 (GRCm39) S358T probably damaging Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Slx1b T C 7: 126,290,939 (GRCm39) probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tbx15 A G 3: 99,233,700 (GRCm39) I288V possibly damaging Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Or8b38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Or8b38 APN 9 37,973,300 (GRCm39) missense possibly damaging 0.58
IGL02441:Or8b38 APN 9 37,973,233 (GRCm39) missense probably benign 0.02
IGL03263:Or8b38 APN 9 37,973,009 (GRCm39) missense probably damaging 0.98
R1748:Or8b38 UTSW 9 37,972,796 (GRCm39) missense probably damaging 1.00
R1870:Or8b38 UTSW 9 37,972,646 (GRCm39) missense probably benign 0.24
R1920:Or8b38 UTSW 9 37,972,981 (GRCm39) missense probably damaging 1.00
R1921:Or8b38 UTSW 9 37,972,981 (GRCm39) missense probably damaging 1.00
R1922:Or8b38 UTSW 9 37,972,981 (GRCm39) missense probably damaging 1.00
R4073:Or8b38 UTSW 9 37,973,165 (GRCm39) missense probably damaging 1.00
R4727:Or8b38 UTSW 9 37,973,389 (GRCm39) missense probably damaging 1.00
R4945:Or8b38 UTSW 9 37,973,068 (GRCm39) missense probably damaging 1.00
R5116:Or8b38 UTSW 9 37,972,634 (GRCm39) missense probably benign
R5233:Or8b38 UTSW 9 37,973,446 (GRCm39) missense probably damaging 0.96
R5923:Or8b38 UTSW 9 37,973,154 (GRCm39) missense probably benign 0.08
R6668:Or8b38 UTSW 9 37,973,066 (GRCm39) missense possibly damaging 0.83
R8035:Or8b38 UTSW 9 37,972,961 (GRCm39) missense probably damaging 0.99
R9392:Or8b38 UTSW 9 37,973,195 (GRCm39) missense probably benign 0.01
R9481:Or8b38 UTSW 9 37,972,707 (GRCm39) missense probably benign 0.01
RF020:Or8b38 UTSW 9 37,972,620 (GRCm39) start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- GTTTGCATGCTGAGACTCACC -3'
(R):5'- TTTCAGTGCAATGTGGACATC -3'

Sequencing Primer
(F):5'- ATGCTGAGACTCACCTTCTGTG -3'
(R):5'- CAGTGCAATGTGGACATCTTTATTCC -3'
Posted On 2016-04-27