Incidental Mutation 'R4950:Mras'
ID381927
Institutional Source Beutler Lab
Gene Symbol Mras
Ensembl Gene ENSMUSG00000032470
Gene Namemuscle and microspikes RAS
Synonyms2900078C09Rik
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R4950 (G1)
Quality Score179
Status Validated
Chromosome9
Chromosomal Location99385420-99437381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99394484 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 111 (L111Q)
Ref Sequence ENSEMBL: ENSMUSP00000121307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035045] [ENSMUST00000119472] [ENSMUST00000122384] [ENSMUST00000123771]
Predicted Effect probably damaging
Transcript: ENSMUST00000035045
AA Change: L111Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035045
Gene: ENSMUSG00000032470
AA Change: L111Q

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119472
AA Change: L111Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112407
Gene: ENSMUSG00000032470
AA Change: L111Q

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122384
AA Change: L111Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113275
Gene: ENSMUSG00000032470
AA Change: L111Q

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123771
AA Change: L111Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121307
Gene: ENSMUSG00000032470
AA Change: L111Q

DomainStartEndE-ValueType
RAS 11 130 1.06e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147078
Meta Mutation Damage Score 0.6032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit a decreased mean percentage of peripheral blood B cells but no other evidence of morphological or neurological defects; mutant astrocytes display normal responsiveness to different trophic factors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Mras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Mras APN 9 99411495 missense probably damaging 1.00
R3918:Mras UTSW 9 99411420 missense probably damaging 1.00
R3919:Mras UTSW 9 99411420 missense probably damaging 1.00
R3981:Mras UTSW 9 99411416 missense probably damaging 1.00
R5375:Mras UTSW 9 99394616 missense probably damaging 1.00
R5501:Mras UTSW 9 99411546 missense probably damaging 1.00
R5624:Mras UTSW 9 99411485 missense probably damaging 0.99
R6349:Mras UTSW 9 99394616 missense probably damaging 1.00
R6350:Mras UTSW 9 99411507 missense probably damaging 1.00
R7453:Mras UTSW 9 99389740 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTGGGAGTAGCTTAGGAACC -3'
(R):5'- GCAGTAGCTTGGGGTTCTAC -3'

Sequencing Primer
(F):5'- GGAGTTACAACAGATGGTTCTCAAC -3'
(R):5'- CAGTCTATAGTGACTCCAATGGG -3'
Posted On2016-04-27