Incidental Mutation 'R4950:Pwp2'
ID 381929
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene Name PWP2 periodic tryptophan protein homolog (yeast)
Synonyms Pwp2, Pwp2h, 6530411D08Rik
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.780) question?
Stock # R4950 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 78006743-78020983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78018840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 56 (Y56H)
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000042556]
AlphaFold Q8BU03
Predicted Effect probably benign
Transcript: ENSMUST00000000384
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042556
AA Change: Y56H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834
AA Change: Y56H

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Elmo2 A T 2: 165,156,733 (GRCm39) probably null Het
Fam186a T C 15: 99,839,534 (GRCm39) R2237G unknown Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Or8b38 T C 9: 37,973,297 (GRCm39) I227T probably damaging Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,707,758 (GRCm39) probably null Het
Rubcn A T 16: 32,663,563 (GRCm39) S358T probably damaging Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Slx1b T C 7: 126,290,939 (GRCm39) probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tbx15 A G 3: 99,233,700 (GRCm39) I288V possibly damaging Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78,014,841 (GRCm39) missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78,014,119 (GRCm39) missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78,019,934 (GRCm39) missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78,014,899 (GRCm39) missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78,014,899 (GRCm39) missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78,016,917 (GRCm39) missense probably benign
IGL02612:Pwp2 APN 10 78,018,828 (GRCm39) missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78,020,921 (GRCm39) start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78,014,304 (GRCm39) missense probably benign 0.38
R0573:Pwp2 UTSW 10 78,018,520 (GRCm39) missense probably benign 0.37
R1835:Pwp2 UTSW 10 78,014,925 (GRCm39) missense probably damaging 1.00
R2097:Pwp2 UTSW 10 78,013,576 (GRCm39) splice site probably benign
R2251:Pwp2 UTSW 10 78,016,922 (GRCm39) missense probably benign 0.04
R2967:Pwp2 UTSW 10 78,018,532 (GRCm39) missense possibly damaging 0.94
R4909:Pwp2 UTSW 10 78,018,328 (GRCm39) missense possibly damaging 0.51
R4970:Pwp2 UTSW 10 78,009,527 (GRCm39) missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78,018,527 (GRCm39) missense probably benign 0.23
R5355:Pwp2 UTSW 10 78,011,378 (GRCm39) missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78,013,605 (GRCm39) missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78,018,835 (GRCm39) missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78,007,952 (GRCm39) missense probably benign 0.00
R5928:Pwp2 UTSW 10 78,018,290 (GRCm39) missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78,012,961 (GRCm39) missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78,018,222 (GRCm39) splice site probably null
R6848:Pwp2 UTSW 10 78,020,127 (GRCm39) splice site probably null
R6897:Pwp2 UTSW 10 78,007,917 (GRCm39) missense probably damaging 1.00
R7060:Pwp2 UTSW 10 78,009,084 (GRCm39) splice site probably null
R7269:Pwp2 UTSW 10 78,012,170 (GRCm39) missense probably benign 0.30
R7367:Pwp2 UTSW 10 78,018,314 (GRCm39) missense probably damaging 1.00
R7368:Pwp2 UTSW 10 78,018,314 (GRCm39) missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78,018,314 (GRCm39) missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78,014,395 (GRCm39) missense probably benign 0.00
R7838:Pwp2 UTSW 10 78,018,778 (GRCm39) critical splice donor site probably null
R7898:Pwp2 UTSW 10 78,009,240 (GRCm39) missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78,007,930 (GRCm39) missense possibly damaging 0.82
R8447:Pwp2 UTSW 10 78,007,873 (GRCm39) missense probably benign 0.10
R8750:Pwp2 UTSW 10 78,013,659 (GRCm39) missense probably damaging 1.00
R9302:Pwp2 UTSW 10 78,009,540 (GRCm39) missense probably benign 0.04
R9367:Pwp2 UTSW 10 78,014,827 (GRCm39) nonsense probably null
Z1177:Pwp2 UTSW 10 78,007,808 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGGAACCTGTGCTATGAAG -3'
(R):5'- AAGAACATACAGCCTTTGCAAG -3'

Sequencing Primer
(F):5'- CTATGAAGCTGAACTTGACCCTAGG -3'
(R):5'- GTGTGCTACCCTTAACTCGAAAAGG -3'
Posted On 2016-04-27