Incidental Mutation 'R4950:Pwp2'
List |< first << previous [record 36 of 53] next >> last >|
ID381929
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene NamePWP2 periodic tryptophan protein homolog (yeast)
SynonymsPwp2, Pwp2h, 6530411D08Rik
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78170909-78185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78183006 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 56 (Y56H)
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000042556]
Predicted Effect probably benign
Transcript: ENSMUST00000000384
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042556
AA Change: Y56H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834
AA Change: Y56H

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78179007 missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78178285 missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78184100 missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78181083 missense probably benign
IGL02612:Pwp2 APN 10 78182994 missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78185087 start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78178470 missense probably benign 0.38
R0573:Pwp2 UTSW 10 78182686 missense probably benign 0.37
R1835:Pwp2 UTSW 10 78179091 missense probably damaging 1.00
R2097:Pwp2 UTSW 10 78177742 splice site probably benign
R2251:Pwp2 UTSW 10 78181088 missense probably benign 0.04
R2967:Pwp2 UTSW 10 78182698 missense possibly damaging 0.94
R4909:Pwp2 UTSW 10 78182494 missense possibly damaging 0.51
R4970:Pwp2 UTSW 10 78173693 missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78182693 missense probably benign 0.23
R5355:Pwp2 UTSW 10 78175544 missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78177771 missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78183001 missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78172118 missense probably benign 0.00
R5928:Pwp2 UTSW 10 78182456 missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78177127 missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78182388 splice site probably null
R6848:Pwp2 UTSW 10 78184293 splice site probably null
R6897:Pwp2 UTSW 10 78172083 missense probably damaging 1.00
R7060:Pwp2 UTSW 10 78173250 splice site probably null
R7269:Pwp2 UTSW 10 78176336 missense probably benign 0.30
R7367:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7368:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78178561 missense probably benign 0.00
R7838:Pwp2 UTSW 10 78182944 critical splice donor site probably null
R7898:Pwp2 UTSW 10 78173406 missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78172096 missense possibly damaging 0.82
R8447:Pwp2 UTSW 10 78172039 missense probably benign 0.10
Z1177:Pwp2 UTSW 10 78171974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGGAACCTGTGCTATGAAG -3'
(R):5'- AAGAACATACAGCCTTTGCAAG -3'

Sequencing Primer
(F):5'- CTATGAAGCTGAACTTGACCCTAGG -3'
(R):5'- GTGTGCTACCCTTAACTCGAAAAGG -3'
Posted On2016-04-27