Incidental Mutation 'R4950:Cage1'
ID381934
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Namecancer antigen 1
SynonymsCtag3, 4933427I01Rik, CAGE1
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38006052-38037069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38023326 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 181 (S181N)
Ref Sequence ENSEMBL: ENSMUSP00000087278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000089840] [ENSMUST00000110233] [ENSMUST00000131066]
Predicted Effect probably benign
Transcript: ENSMUST00000074969
AA Change: S287N

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: S287N

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089840
AA Change: S181N

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087278
Gene: ENSMUSG00000044566
AA Change: S181N

DomainStartEndE-ValueType
Pfam:CAGE1 1 420 6.8e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110233
AA Change: S287N

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: S287N

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131066
AA Change: S287N

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122393
Gene: ENSMUSG00000044566
AA Change: S287N

DomainStartEndE-ValueType
Pfam:CAGE1 1 318 6.5e-167 PFAM
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38022993 nonsense probably null
IGL01736:Cage1 APN 13 38022813 missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38022529 missense probably damaging 1.00
IGL02267:Cage1 APN 13 38023257 missense probably damaging 1.00
IGL03030:Cage1 APN 13 38028147 missense probably benign
IGL03216:Cage1 APN 13 38006177 splice site probably benign
R0487:Cage1 UTSW 13 38025358 missense probably benign 0.00
R0606:Cage1 UTSW 13 38016494 splice site probably benign
R1015:Cage1 UTSW 13 38016475 missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38022880 missense probably damaging 1.00
R1400:Cage1 UTSW 13 38032424 missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38023333 nonsense probably null
R2057:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2058:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2059:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2197:Cage1 UTSW 13 38023053 missense probably damaging 1.00
R3757:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R3758:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38019177 missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38025650 missense probably damaging 1.00
R4401:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4402:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4403:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4490:Cage1 UTSW 13 38023417 missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38025501 missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38019208 missense probably benign 0.33
R4953:Cage1 UTSW 13 38023430 missense possibly damaging 0.51
R5023:Cage1 UTSW 13 38011411 nonsense probably null
R5808:Cage1 UTSW 13 38022325 unclassified probably benign
R5845:Cage1 UTSW 13 38015706 missense probably damaging 0.96
R6278:Cage1 UTSW 13 38016419 missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38025449 missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38022558 missense probably damaging 1.00
R7146:Cage1 UTSW 13 38023049 missense probably benign 0.03
R7192:Cage1 UTSW 13 38019244 missense probably benign
R7529:Cage1 UTSW 13 38025755 missense possibly damaging 0.71
R7580:Cage1 UTSW 13 38022724 missense possibly damaging 0.90
R7646:Cage1 UTSW 13 38022847 missense probably damaging 1.00
R7837:Cage1 UTSW 13 38022405 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAACACGTGCTGTTTGG -3'
(R):5'- AGCTTATGCCGCCTGTTGTG -3'

Sequencing Primer
(F):5'- CAACACGTGCTGTTTGGTGACC -3'
(R):5'- GTGCTCTGCCATGCTGG -3'
Posted On2016-04-27