Incidental Mutation 'R4950:Rarb'
List |< first << previous [record 37 of 53] next >> last >|
ID381936
Institutional Source Beutler Lab
Gene Symbol Rarb
Ensembl Gene ENSMUSG00000017491
Gene Nameretinoic acid receptor, beta
SynonymsRAR beta 2, Hap, RARbeta2
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location16430839-16819156 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 16432085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000225921]
Predicted Effect probably benign
Transcript: ENSMUST00000017629
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000063750
AA Change: P445S
SMART Domains Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491
AA Change: P445S

DomainStartEndE-ValueType
low complexity region 52 75 N/A INTRINSIC
ZnF_C4 78 149 3.77e-40 SMART
HOLI 223 381 1.72e-34 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163032
Predicted Effect probably benign
Transcript: ENSMUST00000223576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224460
Predicted Effect unknown
Transcript: ENSMUST00000225921
AA Change: P399S
Meta Mutation Damage Score 0.1114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Rarb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Rarb APN 14 16443791 nonsense probably null
IGL01483:Rarb APN 14 16432273 splice site probably benign
IGL01591:Rarb APN 14 16434207 missense possibly damaging 0.93
IGL01769:Rarb APN 14 16443760 missense probably damaging 0.97
IGL01782:Rarb APN 14 16434180 missense probably damaging 1.00
IGL01866:Rarb APN 14 16443751 missense probably benign 0.17
IGL03299:Rarb APN 14 16434168 missense probably damaging 1.00
IGL03134:Rarb UTSW 14 16436910 missense probably damaging 0.99
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0849:Rarb UTSW 14 16434293 missense probably damaging 1.00
R1067:Rarb UTSW 14 16436769 missense probably damaging 0.98
R1314:Rarb UTSW 14 16508932 critical splice donor site probably null
R1416:Rarb UTSW 14 16435177 missense possibly damaging 0.82
R2894:Rarb UTSW 14 16435146 missense probably damaging 1.00
R4637:Rarb UTSW 14 16574875 missense possibly damaging 0.51
R5420:Rarb UTSW 14 16434249 missense possibly damaging 0.89
R5456:Rarb UTSW 14 16436843 missense probably damaging 1.00
R5635:Rarb UTSW 14 16443788 missense probably damaging 1.00
R5689:Rarb UTSW 14 16434177 missense probably damaging 1.00
R5708:Rarb UTSW 14 16548545 missense probably damaging 0.99
R5819:Rarb UTSW 14 16443820 missense possibly damaging 0.68
R5935:Rarb UTSW 14 16434264 missense probably damaging 1.00
R6264:Rarb UTSW 14 16818819 missense probably benign 0.31
R6823:Rarb UTSW 14 16443824 missense probably damaging 1.00
R6975:Rarb UTSW 14 16574942 missense possibly damaging 0.92
R7295:Rarb UTSW 14 16508932 critical splice donor site probably null
R7402:Rarb UTSW 14 16548419 missense probably damaging 1.00
R7849:Rarb UTSW 14 16548473 missense probably damaging 1.00
X0065:Rarb UTSW 14 16434303 missense possibly damaging 0.89
Z1177:Rarb UTSW 14 16818725 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGATTCTGGTGGCATGAAATGG -3'
(R):5'- AGGTGCCGAACGTGTAATTAC -3'

Sequencing Primer
(F):5'- ACTTCTTGGTCCTTTTTGAG -3'
(R):5'- CCTTGAAAATGGAAATTCCTGGATC -3'
Posted On2016-04-27