Incidental Mutation 'R4950:Fam186a'
ID 381941
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Name family with sequence similarity 186, member A
Synonyms LOC380973, 1700030F18Rik
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4950 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99816229-99864942 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99839534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 2237 (R2237G)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: R2237G
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: R2237G

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180309
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Elmo2 A T 2: 165,156,733 (GRCm39) probably null Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Or8b38 T C 9: 37,973,297 (GRCm39) I227T probably damaging Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Pwp2 A G 10: 78,018,840 (GRCm39) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,707,758 (GRCm39) probably null Het
Rubcn A T 16: 32,663,563 (GRCm39) S358T probably damaging Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Slx1b T C 7: 126,290,939 (GRCm39) probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tbx15 A G 3: 99,233,700 (GRCm39) I288V possibly damaging Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99,825,572 (GRCm39) splice site probably benign
IGL03047:Fam186a UTSW 15 99,843,589 (GRCm39) missense unknown
R0172:Fam186a UTSW 15 99,852,768 (GRCm39) missense unknown
R0194:Fam186a UTSW 15 99,839,644 (GRCm39) missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99,840,055 (GRCm39) missense probably damaging 0.97
R0799:Fam186a UTSW 15 99,839,893 (GRCm39) missense probably damaging 1.00
R1295:Fam186a UTSW 15 99,837,670 (GRCm39) splice site probably benign
R1366:Fam186a UTSW 15 99,841,270 (GRCm39) missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99,845,536 (GRCm39) missense unknown
R1592:Fam186a UTSW 15 99,838,199 (GRCm39) missense probably benign 0.01
R1636:Fam186a UTSW 15 99,839,539 (GRCm39) missense unknown
R1719:Fam186a UTSW 15 99,840,227 (GRCm39) missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99,864,762 (GRCm39) nonsense probably null
R1856:Fam186a UTSW 15 99,838,183 (GRCm39) missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99,831,557 (GRCm39) unclassified probably benign
R2192:Fam186a UTSW 15 99,838,192 (GRCm39) missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99,852,745 (GRCm39) missense unknown
R2251:Fam186a UTSW 15 99,842,978 (GRCm39) missense probably benign 0.02
R2902:Fam186a UTSW 15 99,843,049 (GRCm39) missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99,841,675 (GRCm39) missense probably damaging 0.99
R3744:Fam186a UTSW 15 99,845,416 (GRCm39) missense unknown
R4021:Fam186a UTSW 15 99,839,680 (GRCm39) missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99,831,566 (GRCm39) unclassified probably benign
R4238:Fam186a UTSW 15 99,841,523 (GRCm39) missense probably benign 0.05
R4667:Fam186a UTSW 15 99,842,413 (GRCm39) missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99,831,419 (GRCm39) unclassified probably benign
R4835:Fam186a UTSW 15 99,843,689 (GRCm39) missense unknown
R4837:Fam186a UTSW 15 99,838,678 (GRCm39) missense unknown
R4897:Fam186a UTSW 15 99,843,158 (GRCm39) missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99,844,723 (GRCm39) missense unknown
R4995:Fam186a UTSW 15 99,842,980 (GRCm39) missense probably benign 0.27
R5062:Fam186a UTSW 15 99,842,527 (GRCm39) missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99,840,977 (GRCm39) missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99,853,374 (GRCm39) missense unknown
R5424:Fam186a UTSW 15 99,843,644 (GRCm39) missense unknown
R5624:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99,844,931 (GRCm39) missense unknown
R5652:Fam186a UTSW 15 99,843,253 (GRCm39) missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99,839,628 (GRCm39) missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99,864,705 (GRCm39) nonsense probably null
R5965:Fam186a UTSW 15 99,842,978 (GRCm39) missense probably benign 0.37
R6044:Fam186a UTSW 15 99,839,878 (GRCm39) missense probably damaging 0.97
R6077:Fam186a UTSW 15 99,840,584 (GRCm39) missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99,838,244 (GRCm39) missense probably benign 0.00
R6185:Fam186a UTSW 15 99,845,530 (GRCm39) missense unknown
R6186:Fam186a UTSW 15 99,845,206 (GRCm39) missense unknown
R6242:Fam186a UTSW 15 99,837,788 (GRCm39) missense unknown
R6351:Fam186a UTSW 15 99,839,623 (GRCm39) missense probably damaging 0.97
R6368:Fam186a UTSW 15 99,841,198 (GRCm39) missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99,845,212 (GRCm39) missense unknown
R6559:Fam186a UTSW 15 99,842,356 (GRCm39) missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99,852,756 (GRCm39) missense unknown
R6867:Fam186a UTSW 15 99,843,731 (GRCm39) missense unknown
R6957:Fam186a UTSW 15 99,844,357 (GRCm39) missense unknown
R6961:Fam186a UTSW 15 99,838,082 (GRCm39) missense probably benign 0.16
R6994:Fam186a UTSW 15 99,840,347 (GRCm39) missense probably benign 0.35
R6996:Fam186a UTSW 15 99,853,374 (GRCm39) missense unknown
R7062:Fam186a UTSW 15 99,831,521 (GRCm39) unclassified probably benign
R7064:Fam186a UTSW 15 99,839,557 (GRCm39) missense unknown
R7173:Fam186a UTSW 15 99,843,531 (GRCm39) missense unknown
R7244:Fam186a UTSW 15 99,844,273 (GRCm39) missense unknown
R7270:Fam186a UTSW 15 99,842,033 (GRCm39) missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99,844,826 (GRCm39) nonsense probably null
R7437:Fam186a UTSW 15 99,840,775 (GRCm39) missense probably damaging 1.00
R7475:Fam186a UTSW 15 99,845,395 (GRCm39) missense unknown
R7487:Fam186a UTSW 15 99,840,017 (GRCm39) missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99,839,796 (GRCm39) missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99,837,788 (GRCm39) missense unknown
R7658:Fam186a UTSW 15 99,837,725 (GRCm39) missense unknown
R7663:Fam186a UTSW 15 99,842,950 (GRCm39) missense probably benign 0.00
R7703:Fam186a UTSW 15 99,852,678 (GRCm39) missense unknown
R7814:Fam186a UTSW 15 99,842,545 (GRCm39) missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99,841,189 (GRCm39) missense probably damaging 0.99
R7970:Fam186a UTSW 15 99,831,467 (GRCm39) missense unknown
R8076:Fam186a UTSW 15 99,841,351 (GRCm39) missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99,839,725 (GRCm39) missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99,841,914 (GRCm39) frame shift probably null
R8239:Fam186a UTSW 15 99,839,191 (GRCm39) missense unknown
R8246:Fam186a UTSW 15 99,838,428 (GRCm39) missense unknown
R8446:Fam186a UTSW 15 99,845,335 (GRCm39) missense unknown
R8469:Fam186a UTSW 15 99,845,186 (GRCm39) missense unknown
R8676:Fam186a UTSW 15 99,845,023 (GRCm39) missense unknown
R8790:Fam186a UTSW 15 99,841,024 (GRCm39) missense possibly damaging 0.90
R8808:Fam186a UTSW 15 99,842,604 (GRCm39) missense possibly damaging 0.83
R8848:Fam186a UTSW 15 99,838,034 (GRCm39) missense possibly damaging 0.83
R9083:Fam186a UTSW 15 99,843,079 (GRCm39) missense probably benign 0.27
R9106:Fam186a UTSW 15 99,844,107 (GRCm39) small deletion probably benign
R9116:Fam186a UTSW 15 99,840,472 (GRCm39) missense possibly damaging 0.95
R9156:Fam186a UTSW 15 99,841,159 (GRCm39) missense possibly damaging 0.46
R9227:Fam186a UTSW 15 99,853,384 (GRCm39) missense unknown
R9250:Fam186a UTSW 15 99,845,330 (GRCm39) missense unknown
R9282:Fam186a UTSW 15 99,839,879 (GRCm39) missense probably damaging 0.97
R9495:Fam186a UTSW 15 99,844,766 (GRCm39) missense unknown
R9514:Fam186a UTSW 15 99,844,766 (GRCm39) missense unknown
R9521:Fam186a UTSW 15 99,841,471 (GRCm39) missense probably damaging 0.97
R9553:Fam186a UTSW 15 99,844,561 (GRCm39) missense unknown
R9641:Fam186a UTSW 15 99,838,244 (GRCm39) missense probably benign 0.00
R9655:Fam186a UTSW 15 99,840,973 (GRCm39) missense probably damaging 0.99
R9661:Fam186a UTSW 15 99,842,492 (GRCm39) missense possibly damaging 0.66
R9673:Fam186a UTSW 15 99,841,024 (GRCm39) missense possibly damaging 0.90
R9762:Fam186a UTSW 15 99,842,393 (GRCm39) missense possibly damaging 0.66
X0021:Fam186a UTSW 15 99,843,316 (GRCm39) missense probably benign 0.00
Z1088:Fam186a UTSW 15 99,843,875 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCCAAATGCCTGGAATGG -3'
(R):5'- TCACTGTCACCCCTAAGCAG -3'

Sequencing Primer
(F):5'- CCAAATGCCTGGAATGGTTGGG -3'
(R):5'- GGGAGTCATTCTTACTCCTGAACAG -3'
Posted On 2016-04-27