Incidental Mutation 'R4950:Rubcn'
ID 381942
Institutional Source Beutler Lab
Gene Symbol Rubcn
Ensembl Gene ENSMUSG00000035629
Gene Name RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms 1700021K19Rik
MMRRC Submission 042547-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R4950 (G1)
Quality Score 211
Status Validated
Chromosome 16
Chromosomal Location 32642072-32698121 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32663563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 358 (S358T)
Ref Sequence ENSEMBL: ENSMUSP00000155943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040986] [ENSMUST00000089684] [ENSMUST00000115105] [ENSMUST00000119810] [ENSMUST00000231478] [ENSMUST00000232269]
AlphaFold Q80U62
Predicted Effect possibly damaging
Transcript: ENSMUST00000040986
AA Change: S358T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048811
Gene: ENSMUSG00000035629
AA Change: S358T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 469 687 1e-66 BLAST
DUF4206 706 908 1.66e-113 SMART
low complexity region 915 941 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089684
AA Change: S358T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087114
Gene: ENSMUSG00000035629
AA Change: S358T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 484 702 1e-66 BLAST
DUF4206 721 923 1.66e-113 SMART
low complexity region 930 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115105
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119810
AA Change: S297T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629
AA Change: S297T

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135480
Predicted Effect possibly damaging
Transcript: ENSMUST00000231478
AA Change: S358T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000232269
AA Change: S358T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,153,579 (GRCm39) D215V probably damaging Het
Cacna1i A G 15: 80,252,872 (GRCm39) E625G probably damaging Het
Cage1 C T 13: 38,207,302 (GRCm39) S181N possibly damaging Het
Ccdc73 A C 2: 104,822,711 (GRCm39) I887L probably benign Het
Cfap65 T A 1: 74,945,495 (GRCm39) K1408* probably null Het
Cngb1 C A 8: 95,975,135 (GRCm39) G654W probably damaging Het
Cxcl15 A T 5: 90,943,104 (GRCm39) E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 (GRCm39) S99P probably benign Het
Disp3 A T 4: 148,342,583 (GRCm39) D622E possibly damaging Het
Dnajc22 G A 15: 98,999,615 (GRCm39) V267I probably benign Het
Dph5 G A 3: 115,722,292 (GRCm39) G257S probably benign Het
Elmo2 A T 2: 165,156,733 (GRCm39) probably null Het
Fam186a T C 15: 99,839,534 (GRCm39) R2237G unknown Het
Fez1 G A 9: 36,779,178 (GRCm39) R285Q probably damaging Het
Fsip2 A T 2: 82,777,276 (GRCm39) H101L probably damaging Het
Fsip2 G A 2: 82,807,758 (GRCm39) C1359Y probably benign Het
Fxyd7 G A 7: 30,746,815 (GRCm39) T15I probably benign Het
Gpr155 A T 2: 73,212,529 (GRCm39) D31E probably benign Het
Iho1 A C 9: 108,298,709 (GRCm39) S36R probably damaging Het
Irx6 A T 8: 93,405,428 (GRCm39) Y432F probably damaging Het
Itih5 A C 2: 10,239,892 (GRCm39) I340L probably damaging Het
Lao1 T C 4: 118,822,572 (GRCm39) L164S probably damaging Het
Mcoln3 T C 3: 145,845,274 (GRCm39) I490T probably damaging Het
Mef2b T C 8: 70,619,846 (GRCm39) Y311H probably damaging Het
Mras A T 9: 99,276,537 (GRCm39) L111Q probably damaging Het
Mrc1 A G 2: 14,276,091 (GRCm39) D475G probably damaging Het
Nrcam T C 12: 44,645,273 (GRCm39) I1155T probably damaging Het
Ntrk1 A G 3: 87,696,918 (GRCm39) probably null Het
Or7e165 G A 9: 19,695,027 (GRCm39) M199I probably benign Het
Or8b38 T C 9: 37,973,297 (GRCm39) I227T probably damaging Het
Parp9 A T 16: 35,768,377 (GRCm39) I186F probably damaging Het
Pcdhac2 T A 18: 37,278,283 (GRCm39) V421E probably benign Het
Pck1 T A 2: 172,996,620 (GRCm39) I178K probably benign Het
Pde6b A G 5: 108,578,569 (GRCm39) K836E probably benign Het
Ptprd T A 4: 76,058,752 (GRCm39) probably null Het
Pwp2 A G 10: 78,018,840 (GRCm39) Y56H probably benign Het
Rarb G A 14: 16,432,085 (GRCm38) probably benign Het
Rpain C G 11: 70,861,747 (GRCm39) H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,707,758 (GRCm39) probably null Het
Ryr2 G A 13: 11,756,897 (GRCm39) R1586C probably damaging Het
Slfn9 T C 11: 82,872,730 (GRCm39) I669V probably benign Het
Slx1b T C 7: 126,290,939 (GRCm39) probably benign Het
Spsb3 T A 17: 25,106,485 (GRCm39) probably benign Het
Tbx15 A G 3: 99,233,700 (GRCm39) I288V possibly damaging Het
Tlr2 C A 3: 83,744,639 (GRCm39) E481D probably damaging Het
Trim17 A T 11: 58,861,254 (GRCm39) D253V probably damaging Het
Trim69 A G 2: 122,009,227 (GRCm39) D429G probably damaging Het
Vstm5 A G 9: 15,169,090 (GRCm39) probably null Het
Vwa3b A G 1: 37,124,413 (GRCm39) Q337R probably benign Het
Zfp113 T C 5: 138,143,734 (GRCm39) N172S probably benign Het
Zfp607a T A 7: 27,578,176 (GRCm39) H415Q probably damaging Het
Zfp87 G A 13: 67,666,018 (GRCm39) T148I probably benign Het
Other mutations in Rubcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rubcn APN 16 32,644,747 (GRCm39) critical splice donor site probably null
IGL00777:Rubcn APN 16 32,656,933 (GRCm39) missense probably damaging 0.98
IGL01402:Rubcn APN 16 32,647,666 (GRCm39) missense probably damaging 1.00
IGL01404:Rubcn APN 16 32,647,666 (GRCm39) missense probably damaging 1.00
IGL02255:Rubcn APN 16 32,647,715 (GRCm39) missense probably benign 0.04
IGL03019:Rubcn APN 16 32,647,077 (GRCm39) missense probably damaging 0.98
IGL03388:Rubcn APN 16 32,661,938 (GRCm39) missense probably benign 0.02
R0254:Rubcn UTSW 16 32,668,316 (GRCm39) missense probably benign 0.00
R0373:Rubcn UTSW 16 32,656,350 (GRCm39) missense probably damaging 1.00
R0636:Rubcn UTSW 16 32,649,056 (GRCm39) missense probably damaging 1.00
R0839:Rubcn UTSW 16 32,647,713 (GRCm39) missense probably damaging 0.98
R0967:Rubcn UTSW 16 32,646,087 (GRCm39) missense probably benign 0.00
R1711:Rubcn UTSW 16 32,663,471 (GRCm39) missense probably damaging 1.00
R1819:Rubcn UTSW 16 32,647,284 (GRCm39) missense possibly damaging 0.93
R1840:Rubcn UTSW 16 32,646,542 (GRCm39) missense possibly damaging 0.83
R2511:Rubcn UTSW 16 32,667,624 (GRCm39) missense probably damaging 1.00
R3932:Rubcn UTSW 16 32,649,629 (GRCm39) splice site probably null
R3933:Rubcn UTSW 16 32,649,629 (GRCm39) splice site probably null
R4384:Rubcn UTSW 16 32,677,272 (GRCm39) missense probably damaging 0.96
R4788:Rubcn UTSW 16 32,656,778 (GRCm39) critical splice donor site probably null
R4852:Rubcn UTSW 16 32,663,678 (GRCm39) missense probably damaging 1.00
R4921:Rubcn UTSW 16 32,667,664 (GRCm39) missense probably damaging 1.00
R5234:Rubcn UTSW 16 32,656,828 (GRCm39) missense probably damaging 1.00
R5527:Rubcn UTSW 16 32,647,081 (GRCm39) missense probably damaging 1.00
R5616:Rubcn UTSW 16 32,647,293 (GRCm39) missense possibly damaging 0.76
R5823:Rubcn UTSW 16 32,670,091 (GRCm39) missense probably damaging 0.98
R6970:Rubcn UTSW 16 32,688,514 (GRCm39) intron probably benign
R7120:Rubcn UTSW 16 32,656,839 (GRCm39) missense probably damaging 1.00
R7121:Rubcn UTSW 16 32,656,839 (GRCm39) missense probably damaging 1.00
R7221:Rubcn UTSW 16 32,687,293 (GRCm39) splice site probably null
R7833:Rubcn UTSW 16 32,688,644 (GRCm39) start gained probably benign
R8108:Rubcn UTSW 16 32,677,320 (GRCm39) missense probably damaging 1.00
R8211:Rubcn UTSW 16 32,656,913 (GRCm39) missense possibly damaging 0.87
R8923:Rubcn UTSW 16 32,646,049 (GRCm39) missense probably damaging 1.00
R9046:Rubcn UTSW 16 32,661,940 (GRCm39) missense probably benign 0.00
R9587:Rubcn UTSW 16 32,663,679 (GRCm39) missense probably damaging 1.00
R9694:Rubcn UTSW 16 32,663,481 (GRCm39) missense probably benign 0.22
X0065:Rubcn UTSW 16 32,668,355 (GRCm39) missense possibly damaging 0.85
Z1176:Rubcn UTSW 16 32,663,533 (GRCm39) missense probably benign 0.00
Z1177:Rubcn UTSW 16 32,645,959 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAATGTTGGTGTCCGAG -3'
(R):5'- TACTCTAGCCCAGGATTCCC -3'

Sequencing Primer
(F):5'- TCCGAGTGGGAGCGAATATG -3'
(R):5'- GCGACAGCACTCTGACTAG -3'
Posted On 2016-04-27