Incidental Mutation 'R4950:Rubcn'
List |< first << previous [record 40 of 53] next >> last >|
ID381942
Institutional Source Beutler Lab
Gene Symbol Rubcn
Ensembl Gene ENSMUSG00000035629
Gene NameRUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms1700021K19Rik
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R4950 (G1)
Quality Score211
Status Validated
Chromosome16
Chromosomal Location32821703-32877766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32843193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 358 (S358T)
Ref Sequence ENSEMBL: ENSMUSP00000155943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040986] [ENSMUST00000089684] [ENSMUST00000115105] [ENSMUST00000119810] [ENSMUST00000231478] [ENSMUST00000232269]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040986
AA Change: S358T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048811
Gene: ENSMUSG00000035629
AA Change: S358T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 469 687 1e-66 BLAST
DUF4206 706 908 1.66e-113 SMART
low complexity region 915 941 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089684
AA Change: S358T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087114
Gene: ENSMUSG00000035629
AA Change: S358T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 484 702 1e-66 BLAST
DUF4206 721 923 1.66e-113 SMART
low complexity region 930 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115105
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119810
AA Change: S297T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629
AA Change: S297T

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135480
Predicted Effect possibly damaging
Transcript: ENSMUST00000231478
AA Change: S358T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000232269
AA Change: S358T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Parp9 A T 16: 35,948,007 I186F probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Rubcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rubcn APN 16 32824377 critical splice donor site probably null
IGL00777:Rubcn APN 16 32836563 missense probably damaging 0.98
IGL01402:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL01404:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL02255:Rubcn APN 16 32827345 missense probably benign 0.04
IGL03019:Rubcn APN 16 32826707 missense probably damaging 0.98
IGL03388:Rubcn APN 16 32841568 missense probably benign 0.02
R0254:Rubcn UTSW 16 32847946 missense probably benign 0.00
R0373:Rubcn UTSW 16 32835980 missense probably damaging 1.00
R0636:Rubcn UTSW 16 32828686 missense probably damaging 1.00
R0839:Rubcn UTSW 16 32827343 missense probably damaging 0.98
R0967:Rubcn UTSW 16 32825717 missense probably benign 0.00
R1711:Rubcn UTSW 16 32843101 missense probably damaging 1.00
R1819:Rubcn UTSW 16 32826914 missense possibly damaging 0.93
R1840:Rubcn UTSW 16 32826172 missense possibly damaging 0.83
R2511:Rubcn UTSW 16 32847254 missense probably damaging 1.00
R3932:Rubcn UTSW 16 32829259 splice site probably null
R3933:Rubcn UTSW 16 32829259 splice site probably null
R4384:Rubcn UTSW 16 32856902 missense probably damaging 0.96
R4788:Rubcn UTSW 16 32836408 critical splice donor site probably null
R4852:Rubcn UTSW 16 32843308 missense probably damaging 1.00
R4921:Rubcn UTSW 16 32847294 missense probably damaging 1.00
R5234:Rubcn UTSW 16 32836458 missense probably damaging 1.00
R5527:Rubcn UTSW 16 32826711 missense probably damaging 1.00
R5616:Rubcn UTSW 16 32826923 missense possibly damaging 0.76
R5823:Rubcn UTSW 16 32849721 missense probably damaging 0.98
R6970:Rubcn UTSW 16 32868144 intron probably benign
R7120:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7121:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7221:Rubcn UTSW 16 32866923 splice site probably null
R7833:Rubcn UTSW 16 32868274 start gained probably benign
R8108:Rubcn UTSW 16 32856950 missense probably damaging 1.00
R8211:Rubcn UTSW 16 32836543 missense possibly damaging 0.87
X0065:Rubcn UTSW 16 32847985 missense possibly damaging 0.85
Z1176:Rubcn UTSW 16 32843163 missense probably benign 0.00
Z1177:Rubcn UTSW 16 32825589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAATGTTGGTGTCCGAG -3'
(R):5'- TACTCTAGCCCAGGATTCCC -3'

Sequencing Primer
(F):5'- TCCGAGTGGGAGCGAATATG -3'
(R):5'- GCGACAGCACTCTGACTAG -3'
Posted On2016-04-27