Incidental Mutation 'R4950:Parp9'
List |< first << previous [record 31 of 53] next >> last >|
ID381943
Institutional Source Beutler Lab
Gene Symbol Parp9
Ensembl Gene ENSMUSG00000022906
Gene Namepoly (ADP-ribose) polymerase family, member 9
Synonyms
MMRRC Submission 042547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4950 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35938470-35972605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35948007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 186 (I186F)
Ref Sequence ENSEMBL: ENSMUSP00000110528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023622] [ENSMUST00000114877] [ENSMUST00000114878] [ENSMUST00000122870]
Predicted Effect probably benign
Transcript: ENSMUST00000023622
SMART Domains Protein: ENSMUSP00000023622
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 74 182 1.5e-16 PFAM
PDB:3HKV|B 386 559 3e-9 PDB
SCOP:d1a26_2 403 521 1e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114877
SMART Domains Protein: ENSMUSP00000110527
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
A1pp 121 257 6.75e-33 SMART
A1pp 325 451 9.37e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114878
AA Change: I186F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110528
Gene: ENSMUSG00000022906
AA Change: I186F

DomainStartEndE-ValueType
A1pp 85 221 6.75e-33 SMART
A1pp 289 415 9.37e-9 SMART
PDB:3HKV|B 619 792 4e-8 PDB
SCOP:d1a26_2 636 754 1e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153066
Predicted Effect probably benign
Transcript: ENSMUST00000159160
SMART Domains Protein: ENSMUSP00000124098
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 29 100 8.3e-9 PFAM
Meta Mutation Damage Score 0.7874 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A T 2: 154,311,659 D215V probably damaging Het
Cacna1i A G 15: 80,368,671 E625G probably damaging Het
Cage1 C T 13: 38,023,326 S181N possibly damaging Het
Ccdc36 A C 9: 108,421,510 S36R probably damaging Het
Ccdc73 A C 2: 104,992,366 I887L probably benign Het
Cfap65 T A 1: 74,906,336 K1408* probably null Het
Cngb1 C A 8: 95,248,507 G654W probably damaging Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Ddi1 A G 9: 6,266,073 S99P probably benign Het
Disp3 A T 4: 148,258,126 D622E possibly damaging Het
Dnajc22 G A 15: 99,101,734 V267I probably benign Het
Dph5 G A 3: 115,928,643 G257S probably benign Het
Elmo2 A T 2: 165,314,813 probably null Het
Fam186a T C 15: 99,941,653 R2237G unknown Het
Fez1 G A 9: 36,867,882 R285Q probably damaging Het
Fsip2 A T 2: 82,946,932 H101L probably damaging Het
Fsip2 G A 2: 82,977,414 C1359Y probably benign Het
Fxyd7 G A 7: 31,047,390 T15I probably benign Het
Gpr155 A T 2: 73,382,185 D31E probably benign Het
Irx6 A T 8: 92,678,800 Y432F probably damaging Het
Itih5 A C 2: 10,235,081 I340L probably damaging Het
Lao1 T C 4: 118,965,375 L164S probably damaging Het
Mcoln3 T C 3: 146,139,519 I490T probably damaging Het
Mef2b T C 8: 70,167,196 Y311H probably damaging Het
Mras A T 9: 99,394,484 L111Q probably damaging Het
Mrc1 A G 2: 14,271,280 D475G probably damaging Het
Nrcam T C 12: 44,598,490 I1155T probably damaging Het
Ntrk1 A G 3: 87,789,611 probably null Het
Olfr58 G A 9: 19,783,731 M199I probably benign Het
Olfr885 T C 9: 38,062,001 I227T probably damaging Het
Pcdhac2 T A 18: 37,145,230 V421E probably benign Het
Pck1 T A 2: 173,154,827 I178K probably benign Het
Pde6b A G 5: 108,430,703 K836E probably benign Het
Ptprd T A 4: 76,140,515 probably null Het
Pwp2 A G 10: 78,183,006 Y56H probably benign Het
Rarb G A 14: 16,432,085 probably benign Het
Rpain C G 11: 70,970,921 H50Q probably benign Het
Rps9 CTGTTTG CTG 7: 3,704,759 probably null Het
Rubcn A T 16: 32,843,193 S358T probably damaging Het
Ryr2 G A 13: 11,742,011 R1586C probably damaging Het
Slfn9 T C 11: 82,981,904 I669V probably benign Het
Slx1b T C 7: 126,691,767 probably benign Het
Spsb3 T A 17: 24,887,511 probably benign Het
Tbx15 A G 3: 99,326,384 I288V possibly damaging Het
Tlr2 C A 3: 83,837,332 E481D probably damaging Het
Trim17 A T 11: 58,970,428 D253V probably damaging Het
Trim69 A G 2: 122,178,746 D429G probably damaging Het
Vstm5 A G 9: 15,257,794 probably null Het
Vwa3b A G 1: 37,085,332 Q337R probably benign Het
Zfp113 T C 5: 138,145,472 N172S probably benign Het
Zfp607a T A 7: 27,878,751 H415Q probably damaging Het
Zfp87 G A 13: 67,517,899 T148I probably benign Het
Other mutations in Parp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Parp9 APN 16 35947998 missense probably damaging 1.00
IGL01365:Parp9 APN 16 35947954 missense possibly damaging 0.71
IGL01628:Parp9 APN 16 35956915 missense possibly damaging 0.58
IGL02274:Parp9 APN 16 35947947 missense probably damaging 1.00
IGL02693:Parp9 APN 16 35956970 missense probably benign 0.01
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R0559:Parp9 UTSW 16 35947992 missense probably benign 0.00
R1126:Parp9 UTSW 16 35947740 missense possibly damaging 0.53
R1346:Parp9 UTSW 16 35956897 missense probably benign 0.00
R1472:Parp9 UTSW 16 35953680 missense possibly damaging 0.78
R1642:Parp9 UTSW 16 35967697 missense probably benign 0.37
R1900:Parp9 UTSW 16 35972221 missense probably benign 0.00
R2055:Parp9 UTSW 16 35953614 missense probably damaging 0.97
R3177:Parp9 UTSW 16 35948208 missense probably damaging 0.99
R3277:Parp9 UTSW 16 35948208 missense probably damaging 0.99
R4039:Parp9 UTSW 16 35960047 missense probably damaging 1.00
R4869:Parp9 UTSW 16 35956904 missense probably damaging 0.99
R5112:Parp9 UTSW 16 35964313 missense probably damaging 1.00
R5117:Parp9 UTSW 16 35971832 splice site probably null
R5180:Parp9 UTSW 16 35953736 nonsense probably null
R5415:Parp9 UTSW 16 35943382 missense probably damaging 0.97
R5535:Parp9 UTSW 16 35956825 missense probably damaging 0.98
R5727:Parp9 UTSW 16 35964097 nonsense probably null
R5842:Parp9 UTSW 16 35943408 missense possibly damaging 0.46
R5942:Parp9 UTSW 16 35971889 missense possibly damaging 0.90
R6110:Parp9 UTSW 16 35953626 missense possibly damaging 0.86
R6193:Parp9 UTSW 16 35947551 missense possibly damaging 0.64
R6707:Parp9 UTSW 16 35947933 missense probably damaging 1.00
R6957:Parp9 UTSW 16 35948346 missense probably benign 0.00
R7014:Parp9 UTSW 16 35960063 critical splice donor site probably null
R7064:Parp9 UTSW 16 35953672 missense probably benign 0.07
R7205:Parp9 UTSW 16 35956990 missense probably benign 0.00
R7221:Parp9 UTSW 16 35953701 missense probably benign 0.00
R7693:Parp9 UTSW 16 35956912 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTTGGTGAAAACTGGTGGC -3'
(R):5'- AACAGTGGGGTCCTCATTGC -3'

Sequencing Primer
(F):5'- ACTGGTGGCTTTGAAATCCAAG -3'
(R):5'- GGTCCTCATTGCTCACCAGATG -3'
Posted On2016-04-27