Mutagenetix > Incidental Mutation

Incidental Mutation 'R0401:Cad'

38195

Institutional Source

Beutler Lab

Gene Symbol

Cad

Ensembl Gene

ENSMUSG00000013629

Gene Name

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Synonyms

MMRRC Submission

038606-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R0401 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

31054780-31078479 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 31073986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]

AlphaFold

B2RQC6

Predicted Effect

probably benign
Transcript: ENSMUST00000013773

SMART Domains

Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.7e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.2e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.8e-85	PFAM
Pfam:ATP-grasp	522	690	1.5e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.2e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.8e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.4e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1924	2065	1.9e-44	PFAM
Pfam:OTCace	2071	2221	7.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200917

Predicted Effect

probably benign
Transcript: ENSMUST00000200953

SMART Domains

Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:CPSase_L_D2	514	616	1.5e-34	PFAM
Pfam:Dala_Dala_lig_C	527	625	2.4e-7	PFAM
Pfam:CPSase_L_D2	614	655	4.9e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:ATP-grasp_4	981	1160	1.7e-23	PFAM
Pfam:CPSase_L_D2	984	1187	3e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	2.3e-7	PFAM
Pfam:ATP-grasp	992	1159	2.1e-12	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_1	1399	1667	7.1e-12	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2002	1.8e-44	PFAM
Pfam:OTCace	2008	2158	7.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201182

SMART Domains

Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.1e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.7e-85	PFAM
Pfam:ATP-grasp	522	690	1.4e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.1e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.7e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.1e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1949	1994	1.4e-11	PFAM
Pfam:OTCace	2000	2150	7.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201256

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201870

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202391

Predicted Effect

probably benign
Transcript: ENSMUST00000202795

SMART Domains

Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	1.9e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	5.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	1.2e-85	PFAM
Pfam:ATP-grasp	522	690	7.3e-10	PFAM
Pfam:Dala_Dala_lig_C	527	687	1.3e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	8.9e-24	PFAM
Pfam:CPSase_L_D2	1047	1250	2.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	1.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	1.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	2.5e-11	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1970	2004	4.6e-11	PFAM
Pfam:OTCace	2010	2160	9.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202827

Predicted Effect

probably benign
Transcript: ENSMUST00000202973

SMART Domains

Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
SCOP:d1gkra1	1	84	4e-28	SMART
PDB:4C6N\|A	1	119	4e-58	PDB
low complexity region	156	170	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.6%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,070,306	H1752L	possibly damaging	Het
8030462N17Rik	C	A	18: 77,673,962	S218I	probably damaging	Het
A530099J19Rik	A	T	13: 19,729,494		noncoding transcript	Het
Abcc5	T	C	16: 20,376,558	K730E	probably benign	Het
Ahnak	A	G	19: 9,015,116	D4588G	probably benign	Het
AI467606	G	A	7: 127,092,436	R61H	probably damaging	Het
Apoa4	T	A	9: 46,243,058	V319E	probably damaging	Het
Atad5	T	A	11: 80,120,699	D1297E	probably benign	Het
BC005624	G	A	2: 30,980,009	T62I	probably benign	Het
Bcl6	T	C	16: 23,972,594	K337E	probably damaging	Het
Ccdc73	T	C	2: 104,991,289	S528P	probably benign	Het
Ccng2	T	G	5: 93,273,413	C261G	possibly damaging	Het
Cdh11	A	T	8: 102,674,006	I110N	probably damaging	Het
Cgnl1	A	G	9: 71,705,239	V767A	probably damaging	Het
Cit	A	G	5: 115,985,479	T1460A	probably benign	Het
Clec4b2	C	T	6: 123,181,300	Q42*	probably null	Het
Clip1	A	G	5: 123,653,789	V106A	probably damaging	Het
Crb1	T	C	1: 139,198,791		probably benign	Het
Cts6	T	C	13: 61,198,339		probably benign	Het
Cul9	T	C	17: 46,541,704	E244G	probably damaging	Het
Ddx55	A	T	5: 124,567,951	I480F	probably damaging	Het
Dixdc1	A	G	9: 50,693,674	S17P	possibly damaging	Het
Drosha	T	A	15: 12,926,031	Y1235*	probably null	Het
Dsg2	G	T	18: 20,592,508		probably benign	Het
E2f5	T	C	3: 14,579,025		probably null	Het
Epc2	A	G	2: 49,528,974	T265A	probably damaging	Het
Etaa1	T	G	11: 17,947,514	D201A	probably damaging	Het
Fancd2	T	C	6: 113,548,343	I260T	possibly damaging	Het
Fhdc1	G	A	3: 84,444,624	A1098V	probably benign	Het
Gm17689	G	T	9: 36,582,628	A3E	unknown	Het
Gm7030	C	T	17: 36,128,705	V128M	probably damaging	Het
Gpd2	G	A	2: 57,340,093	V286I	possibly damaging	Het
Herc2	A	C	7: 56,157,732	E2523A	probably damaging	Het
Jmjd1c	G	A	10: 67,220,382	R527H	probably damaging	Het
Kif12	G	A	4: 63,169,525		probably benign	Het
Lrp2	A	T	2: 69,479,148	N2802K	probably damaging	Het
Mab21l2	C	G	3: 86,546,989	G235R	probably benign	Het
Mapk8	T	C	14: 33,382,208	E417G	probably benign	Het
Mapk8ip3	G	A	17: 24,909,171		probably benign	Het
Mettl1	A	G	10: 127,045,077	T203A	probably benign	Het
Mettl9	T	C	7: 121,076,313	V312A	probably damaging	Het
Mex3d	A	G	10: 80,386,894	V176A	probably benign	Het
Mmp3	T	C	9: 7,449,790	S225P	probably damaging	Het
Mrvi1	G	A	7: 110,876,897	P757S	probably benign	Het
Neb	G	A	2: 52,188,677		probably benign	Het
Ninj2	C	T	6: 120,198,051	A51V	possibly damaging	Het
Nle1	A	G	11: 82,905,379		probably benign	Het
Nol9	T	C	4: 152,052,605	Y532H	probably benign	Het
Nr2c1	T	A	10: 94,171,158	V286E	probably benign	Het
Olfr1183	T	G	2: 88,461,925	L195R	probably damaging	Het
Olfr1272	A	T	2: 90,282,404	M57K	probably damaging	Het
Olfr308	T	C	7: 86,321,292	Y220C	probably benign	Het
Olfr481	T	A	7: 108,080,872	I26N	possibly damaging	Het
Olfr670	T	A	7: 104,959,943	H263L	probably damaging	Het
Olfr816	A	G	10: 129,911,916	Y121H	probably benign	Het
Olfr827	A	G	10: 130,210,620	L170P	probably damaging	Het
Ovch2	A	T	7: 107,801,136	V15D	probably damaging	Het
Pclo	T	G	5: 14,681,734	S3417A	unknown	Het
Pet2	C	A	X: 89,405,209	R438L	probably benign	Het
Pex1	T	A	5: 3,633,759	M1085K	probably damaging	Het
Plscr2	T	C	9: 92,282,135	S6P	probably benign	Het
Pogz	C	T	3: 94,877,025	P722S	possibly damaging	Het
Pom121l2	A	T	13: 21,982,225	D222V	probably benign	Het
Prpf40a	T	C	2: 53,159,313	Y179C	probably damaging	Het
R3hdm2	A	G	10: 127,458,173	I179V	possibly damaging	Het
Ranbp9	A	C	13: 43,422,658	V355G	probably damaging	Het
Rims2	T	C	15: 39,509,632		probably benign	Het
Ryr2	A	T	13: 11,705,684	S2693T	probably benign	Het
Sbno1	G	A	5: 124,410,285	T111I	probably damaging	Het
Sdk1	A	C	5: 142,046,161	N997T	possibly damaging	Het
Setx	G	T	2: 29,166,289	E39*	probably null	Het
Skint7	T	A	4: 111,980,362	N112K	probably damaging	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	A	T	2: 62,190,848	D80V	probably benign	Het
Susd2	C	A	10: 75,638,603		probably benign	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcf3	G	T	10: 80,421,158	S77R	probably damaging	Het
Tdpoz3	T	C	3: 93,826,365	Y116H	probably benign	Het
Tex26	C	A	5: 149,460,858	D164E	probably benign	Het
Thoc5	G	A	11: 4,902,213		probably benign	Het
Tiparp	A	G	3: 65,531,436	R58G	probably benign	Het
Trim66	A	T	7: 109,475,264	C597S	probably damaging	Het
Ugt2a3	T	A	5: 87,336,490	Q225L	probably benign	Het
Vmn1r25	T	A	6: 57,978,711	I198L	probably benign	Het
Vmn2r106	A	T	17: 20,279,019	V210D	possibly damaging	Het
Vmn2r124	T	C	17: 18,064,145	F483L	probably damaging	Het
Vmn2r78	A	G	7: 86,921,311	K346E	probably benign	Het
Zfhx4	T	A	3: 5,401,161	S2126R	possibly damaging	Het
Zfp608	C	T	18: 54,898,994	G625R	probably benign	Het
Zkscan5	A	G	5: 145,212,575	D234G	probably damaging	Het
Zscan10	T	A	17: 23,605,915	V115E	probably damaging	Het

Other mutations in Cad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Cad	APN	5	31061484	missense	probably damaging	1.00
IGL00908:Cad	APN	5	31059054	missense	possibly damaging	0.93
IGL01068:Cad	APN	5	31061770	splice site	probably benign
IGL01638:Cad	APN	5	31067614	missense	probably damaging	1.00
IGL02483:Cad	APN	5	31060826	critical splice acceptor site	probably null
IGL02499:Cad	APN	5	31069604	missense	probably damaging	1.00
IGL02691:Cad	APN	5	31055294	missense	probably damaging	1.00
IGL03002:Cad	APN	5	31054986	missense	probably benign	0.00
PIT4696001:Cad	UTSW	5	31072094	missense	probably damaging	0.99
R0212:Cad	UTSW	5	31078110	missense	probably damaging	1.00
R0317:Cad	UTSW	5	31072321	missense	probably benign	0.01
R0335:Cad	UTSW	5	31073985	unclassified	probably benign
R0445:Cad	UTSW	5	31072709	missense	probably benign	0.08
R0494:Cad	UTSW	5	31077512	unclassified	probably benign
R0532:Cad	UTSW	5	31062187	splice site	probably benign
R0539:Cad	UTSW	5	31075457	splice site	probably benign
R0578:Cad	UTSW	5	31058776	missense	probably benign	0.01
R0590:Cad	UTSW	5	31062231	missense	probably damaging	1.00
R0638:Cad	UTSW	5	31077688	missense	probably damaging	0.98
R0831:Cad	UTSW	5	31067600	missense	probably damaging	1.00
R1329:Cad	UTSW	5	31059582	missense	probably damaging	1.00
R1513:Cad	UTSW	5	31068762	missense	probably damaging	1.00
R1531:Cad	UTSW	5	31076219	missense	probably benign	0.14
R1763:Cad	UTSW	5	31060951	missense	probably damaging	1.00
R1785:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R1786:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2131:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2165:Cad	UTSW	5	31062220	missense	probably damaging	1.00
R3103:Cad	UTSW	5	31061674	missense	possibly damaging	0.95
R3113:Cad	UTSW	5	31074137	missense	possibly damaging	0.50
R3762:Cad	UTSW	5	31075546	splice site	probably null
R3847:Cad	UTSW	5	31061650	missense	probably damaging	1.00
R3898:Cad	UTSW	5	31074022	missense	probably benign	0.06
R3943:Cad	UTSW	5	31072385	critical splice donor site	probably null
R4213:Cad	UTSW	5	31072344	missense	probably benign	0.01
R4458:Cad	UTSW	5	31061226	missense	probably damaging	1.00
R4562:Cad	UTSW	5	31058133	missense	possibly damaging	0.82
R4629:Cad	UTSW	5	31070295	missense	probably damaging	1.00
R4717:Cad	UTSW	5	31066686	critical splice acceptor site	probably null
R4811:Cad	UTSW	5	31074690	missense	probably benign	0.02
R5044:Cad	UTSW	5	31055021	missense	probably benign	0.00
R5630:Cad	UTSW	5	31060573	missense	probably damaging	1.00
R5660:Cad	UTSW	5	31076847	missense	probably damaging	1.00
R6008:Cad	UTSW	5	31069112	missense	probably damaging	1.00
R6029:Cad	UTSW	5	31054983	missense	possibly damaging	0.65
R6073:Cad	UTSW	5	31062562	missense	possibly damaging	0.84
R6240:Cad	UTSW	5	31072978	missense	probably benign	0.00
R6260:Cad	UTSW	5	31066800	missense	probably null
R7145:Cad	UTSW	5	31067612	missense	possibly damaging	0.89
R7303:Cad	UTSW	5	31060213	critical splice donor site	probably null
R7352:Cad	UTSW	5	31058078	missense	probably damaging	1.00
R7382:Cad	UTSW	5	31075829	missense	probably benign
R7387:Cad	UTSW	5	31061940	missense	probably damaging	1.00
R7455:Cad	UTSW	5	31074162	missense	probably damaging	0.99
R7596:Cad	UTSW	5	31069048	missense	probably benign
R7627:Cad	UTSW	5	31060164	missense	probably damaging	1.00
R7898:Cad	UTSW	5	31061485	missense	probably damaging	1.00
R8022:Cad	UTSW	5	31068806	missense	probably damaging	1.00
R8115:Cad	UTSW	5	31060927	missense	possibly damaging	0.82
R8511:Cad	UTSW	5	31075821	missense	probably benign	0.00
R8523:Cad	UTSW	5	31058106	missense	probably damaging	0.98
R8690:Cad	UTSW	5	31075156	missense	possibly damaging	0.58
R8697:Cad	UTSW	5	31074601	missense	probably benign	0.06
R8698:Cad	UTSW	5	31077475	missense	probably benign
R8699:Cad	UTSW	5	31076261	missense	possibly damaging	0.80
R8803:Cad	UTSW	5	31069564	missense	probably damaging	1.00
R9262:Cad	UTSW	5	31067665	missense	probably null
R9272:Cad	UTSW	5	31061232	missense	possibly damaging	0.91
R9287:Cad	UTSW	5	31072656	missense	possibly damaging	0.67
R9314:Cad	UTSW	5	31077644	missense	probably damaging	1.00
R9609:Cad	UTSW	5	31070674	critical splice donor site	probably null
R9665:Cad	UTSW	5	31072359	missense	probably benign	0.28
RF001:Cad	UTSW	5	31060212	critical splice donor site	probably benign
RF012:Cad	UTSW	5	31060212	critical splice donor site	probably benign
X0021:Cad	UTSW	5	31068131	missense	probably null	1.00
X0022:Cad	UTSW	5	31072317	missense	probably damaging	0.99
Z1177:Cad	UTSW	5	31068421	missense	probably damaging	1.00
Z1177:Cad	UTSW	5	31075128	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TTGTGCCCCAACTCAAGCTGTAGG -3'
(R):5'- CTGTCAAGGGTCAAGGGTCAAGTC -3'

Sequencing Primer
(F):5'- TCCTTAAGCACAGGGATTGAC -3'
(R):5'- CTACATAGGTGTCCTCCTGGAGAG -3'

Posted On

2013-05-23