Incidental Mutation 'R0401:Cad'
ID 38195
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Name carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms 2410008J01Rik
MMRRC Submission 038606-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R0401 (G1)
Quality Score 215
Status Validated
Chromosome 5
Chromosomal Location 31212124-31235823 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 31231330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]
AlphaFold B2RQC6
Predicted Effect probably benign
Transcript: ENSMUST00000013773
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200917
Predicted Effect probably benign
Transcript: ENSMUST00000200953
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201182
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201870
Predicted Effect probably benign
Transcript: ENSMUST00000202795
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202391
Predicted Effect probably benign
Transcript: ENSMUST00000202973
SMART Domains Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
SCOP:d1gkra1 1 84 4e-28 SMART
PDB:4C6N|A 1 119 4e-58 PDB
low complexity region 156 170 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,776,067 (GRCm39) H1752L possibly damaging Het
Abcc5 T C 16: 20,195,308 (GRCm39) K730E probably benign Het
Ahnak A G 19: 8,992,480 (GRCm39) D4588G probably benign Het
AI467606 G A 7: 126,691,608 (GRCm39) R61H probably damaging Het
Apoa4 T A 9: 46,154,356 (GRCm39) V319E probably damaging Het
Ark2n C A 18: 77,761,658 (GRCm39) S218I probably damaging Het
Atad5 T A 11: 80,011,525 (GRCm39) D1297E probably benign Het
BC005624 G A 2: 30,870,021 (GRCm39) T62I probably benign Het
Bcl6 T C 16: 23,791,344 (GRCm39) K337E probably damaging Het
Ccdc73 T C 2: 104,821,634 (GRCm39) S528P probably benign Het
Ccng2 T G 5: 93,421,272 (GRCm39) C261G possibly damaging Het
Cdh11 A T 8: 103,400,638 (GRCm39) I110N probably damaging Het
Cgnl1 A G 9: 71,612,521 (GRCm39) V767A probably damaging Het
Cit A G 5: 116,123,538 (GRCm39) T1460A probably benign Het
Clec4b2 C T 6: 123,158,259 (GRCm39) Q42* probably null Het
Clip1 A G 5: 123,791,852 (GRCm39) V106A probably damaging Het
Crb1 T C 1: 139,126,529 (GRCm39) probably benign Het
Cts6 T C 13: 61,346,153 (GRCm39) probably benign Het
Cul9 T C 17: 46,852,630 (GRCm39) E244G probably damaging Het
Dcaf8l C A X: 88,448,815 (GRCm39) R438L probably benign Het
Ddx55 A T 5: 124,706,014 (GRCm39) I480F probably damaging Het
Dixdc1 A G 9: 50,604,974 (GRCm39) S17P possibly damaging Het
Drosha T A 15: 12,926,117 (GRCm39) Y1235* probably null Het
Dsg2 G T 18: 20,725,565 (GRCm39) probably benign Het
E2f5 T C 3: 14,644,085 (GRCm39) probably null Het
Epc2 A G 2: 49,418,986 (GRCm39) T265A probably damaging Het
Etaa1 T G 11: 17,897,514 (GRCm39) D201A probably damaging Het
Fancd2 T C 6: 113,525,304 (GRCm39) I260T possibly damaging Het
Fhdc1 G A 3: 84,351,931 (GRCm39) A1098V probably benign Het
Gpd2 G A 2: 57,230,105 (GRCm39) V286I possibly damaging Het
Gpr141b A T 13: 19,913,664 (GRCm39) noncoding transcript Het
H2-T9 C T 17: 36,439,597 (GRCm39) V128M probably damaging Het
Herc2 A C 7: 55,807,480 (GRCm39) E2523A probably damaging Het
Irag1 G A 7: 110,476,104 (GRCm39) P757S probably benign Het
Jmjd1c G A 10: 67,056,161 (GRCm39) R527H probably damaging Het
Kif12 G A 4: 63,087,762 (GRCm39) probably benign Het
Lrp2 A T 2: 69,309,492 (GRCm39) N2802K probably damaging Het
Mab21l2 C G 3: 86,454,296 (GRCm39) G235R probably benign Het
Mapk8 T C 14: 33,104,165 (GRCm39) E417G probably benign Het
Mapk8ip3 G A 17: 25,128,145 (GRCm39) probably benign Het
Mettl1 A G 10: 126,880,946 (GRCm39) T203A probably benign Het
Mettl9 T C 7: 120,675,536 (GRCm39) V312A probably damaging Het
Mex3d A G 10: 80,222,728 (GRCm39) V176A probably benign Het
Mmp3 T C 9: 7,449,790 (GRCm39) S225P probably damaging Het
Neb G A 2: 52,078,689 (GRCm39) probably benign Het
Ninj2 C T 6: 120,175,012 (GRCm39) A51V possibly damaging Het
Nle1 A G 11: 82,796,205 (GRCm39) probably benign Het
Nol9 T C 4: 152,137,062 (GRCm39) Y532H probably benign Het
Nr2c1 T A 10: 94,007,020 (GRCm39) V286E probably benign Het
Or4b1b A T 2: 90,112,748 (GRCm39) M57K probably damaging Het
Or4c31 T G 2: 88,292,269 (GRCm39) L195R probably damaging Het
Or52e18 T A 7: 104,609,150 (GRCm39) H263L probably damaging Het
Or5p4 T A 7: 107,680,079 (GRCm39) I26N possibly damaging Het
Or6c69 A G 10: 129,747,785 (GRCm39) Y121H probably benign Het
Or6f1 T C 7: 85,970,500 (GRCm39) Y220C probably benign Het
Or9k7 A G 10: 130,046,489 (GRCm39) L170P probably damaging Het
Ovch2 A T 7: 107,400,343 (GRCm39) V15D probably damaging Het
Pate8 G T 9: 36,493,924 (GRCm39) A3E unknown Het
Pclo T G 5: 14,731,748 (GRCm39) S3417A unknown Het
Pex1 T A 5: 3,683,759 (GRCm39) M1085K probably damaging Het
Plscr2 T C 9: 92,164,188 (GRCm39) S6P probably benign Het
Pogz C T 3: 94,784,336 (GRCm39) P722S possibly damaging Het
Pom121l2 A T 13: 22,166,395 (GRCm39) D222V probably benign Het
Prpf40a T C 2: 53,049,325 (GRCm39) Y179C probably damaging Het
R3hdm2 A G 10: 127,294,042 (GRCm39) I179V possibly damaging Het
Ranbp9 A C 13: 43,576,134 (GRCm39) V355G probably damaging Het
Rims2 T C 15: 39,373,028 (GRCm39) probably benign Het
Ryr2 A T 13: 11,720,570 (GRCm39) S2693T probably benign Het
Sbno1 G A 5: 124,548,348 (GRCm39) T111I probably damaging Het
Sdk1 A C 5: 142,031,916 (GRCm39) N997T possibly damaging Het
Setx G T 2: 29,056,301 (GRCm39) E39* probably null Het
Skint7 T A 4: 111,837,559 (GRCm39) N112K probably damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a10 A T 2: 62,021,192 (GRCm39) D80V probably benign Het
Susd2 C A 10: 75,474,437 (GRCm39) probably benign Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Tcf3 G T 10: 80,256,992 (GRCm39) S77R probably damaging Het
Tdpoz3 T C 3: 93,733,672 (GRCm39) Y116H probably benign Het
Tex26 C A 5: 149,384,323 (GRCm39) D164E probably benign Het
Thoc5 G A 11: 4,852,213 (GRCm39) probably benign Het
Tiparp A G 3: 65,438,857 (GRCm39) R58G probably benign Het
Trim66 A T 7: 109,074,471 (GRCm39) C597S probably damaging Het
Ugt2a3 T A 5: 87,484,349 (GRCm39) Q225L probably benign Het
Vmn1r25 T A 6: 57,955,696 (GRCm39) I198L probably benign Het
Vmn2r106 A T 17: 20,499,281 (GRCm39) V210D possibly damaging Het
Vmn2r124 T C 17: 18,284,407 (GRCm39) F483L probably damaging Het
Vmn2r78 A G 7: 86,570,519 (GRCm39) K346E probably benign Het
Zfhx4 T A 3: 5,466,221 (GRCm39) S2126R possibly damaging Het
Zfp608 C T 18: 55,032,066 (GRCm39) G625R probably benign Het
Zkscan5 A G 5: 145,149,385 (GRCm39) D234G probably damaging Het
Zscan10 T A 17: 23,824,889 (GRCm39) V115E probably damaging Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31,218,828 (GRCm39) missense probably damaging 1.00
IGL00908:Cad APN 5 31,216,398 (GRCm39) missense possibly damaging 0.93
IGL01068:Cad APN 5 31,219,114 (GRCm39) splice site probably benign
IGL01638:Cad APN 5 31,224,958 (GRCm39) missense probably damaging 1.00
IGL02483:Cad APN 5 31,218,170 (GRCm39) critical splice acceptor site probably null
IGL02499:Cad APN 5 31,226,948 (GRCm39) missense probably damaging 1.00
IGL02691:Cad APN 5 31,212,638 (GRCm39) missense probably damaging 1.00
IGL03002:Cad APN 5 31,212,330 (GRCm39) missense probably benign 0.00
PIT4696001:Cad UTSW 5 31,229,438 (GRCm39) missense probably damaging 0.99
R0212:Cad UTSW 5 31,235,454 (GRCm39) missense probably damaging 1.00
R0317:Cad UTSW 5 31,229,665 (GRCm39) missense probably benign 0.01
R0335:Cad UTSW 5 31,231,329 (GRCm39) unclassified probably benign
R0445:Cad UTSW 5 31,230,053 (GRCm39) missense probably benign 0.08
R0494:Cad UTSW 5 31,234,856 (GRCm39) unclassified probably benign
R0532:Cad UTSW 5 31,219,531 (GRCm39) splice site probably benign
R0539:Cad UTSW 5 31,232,801 (GRCm39) splice site probably benign
R0578:Cad UTSW 5 31,216,120 (GRCm39) missense probably benign 0.01
R0590:Cad UTSW 5 31,219,575 (GRCm39) missense probably damaging 1.00
R0638:Cad UTSW 5 31,235,032 (GRCm39) missense probably damaging 0.98
R0831:Cad UTSW 5 31,224,944 (GRCm39) missense probably damaging 1.00
R1329:Cad UTSW 5 31,216,926 (GRCm39) missense probably damaging 1.00
R1513:Cad UTSW 5 31,226,106 (GRCm39) missense probably damaging 1.00
R1531:Cad UTSW 5 31,233,563 (GRCm39) missense probably benign 0.14
R1763:Cad UTSW 5 31,218,295 (GRCm39) missense probably damaging 1.00
R1785:Cad UTSW 5 31,215,416 (GRCm39) missense probably damaging 1.00
R1786:Cad UTSW 5 31,215,416 (GRCm39) missense probably damaging 1.00
R2131:Cad UTSW 5 31,215,416 (GRCm39) missense probably damaging 1.00
R2165:Cad UTSW 5 31,219,564 (GRCm39) missense probably damaging 1.00
R3103:Cad UTSW 5 31,219,018 (GRCm39) missense possibly damaging 0.95
R3113:Cad UTSW 5 31,231,481 (GRCm39) missense possibly damaging 0.50
R3762:Cad UTSW 5 31,232,890 (GRCm39) splice site probably null
R3847:Cad UTSW 5 31,218,994 (GRCm39) missense probably damaging 1.00
R3898:Cad UTSW 5 31,231,366 (GRCm39) missense probably benign 0.06
R3943:Cad UTSW 5 31,229,729 (GRCm39) critical splice donor site probably null
R4213:Cad UTSW 5 31,229,688 (GRCm39) missense probably benign 0.01
R4458:Cad UTSW 5 31,218,570 (GRCm39) missense probably damaging 1.00
R4562:Cad UTSW 5 31,215,477 (GRCm39) missense possibly damaging 0.82
R4629:Cad UTSW 5 31,227,639 (GRCm39) missense probably damaging 1.00
R4717:Cad UTSW 5 31,224,030 (GRCm39) critical splice acceptor site probably null
R4811:Cad UTSW 5 31,232,034 (GRCm39) missense probably benign 0.02
R5044:Cad UTSW 5 31,212,365 (GRCm39) missense probably benign 0.00
R5630:Cad UTSW 5 31,217,917 (GRCm39) missense probably damaging 1.00
R5660:Cad UTSW 5 31,234,191 (GRCm39) missense probably damaging 1.00
R6008:Cad UTSW 5 31,226,456 (GRCm39) missense probably damaging 1.00
R6029:Cad UTSW 5 31,212,327 (GRCm39) missense possibly damaging 0.65
R6073:Cad UTSW 5 31,219,906 (GRCm39) missense possibly damaging 0.84
R6240:Cad UTSW 5 31,230,322 (GRCm39) missense probably benign 0.00
R6260:Cad UTSW 5 31,224,144 (GRCm39) missense probably null
R7145:Cad UTSW 5 31,224,956 (GRCm39) missense possibly damaging 0.89
R7303:Cad UTSW 5 31,217,557 (GRCm39) critical splice donor site probably null
R7352:Cad UTSW 5 31,215,422 (GRCm39) missense probably damaging 1.00
R7382:Cad UTSW 5 31,233,173 (GRCm39) missense probably benign
R7387:Cad UTSW 5 31,219,284 (GRCm39) missense probably damaging 1.00
R7455:Cad UTSW 5 31,231,506 (GRCm39) missense probably damaging 0.99
R7596:Cad UTSW 5 31,226,392 (GRCm39) missense probably benign
R7627:Cad UTSW 5 31,217,508 (GRCm39) missense probably damaging 1.00
R7898:Cad UTSW 5 31,218,829 (GRCm39) missense probably damaging 1.00
R8022:Cad UTSW 5 31,226,150 (GRCm39) missense probably damaging 1.00
R8115:Cad UTSW 5 31,218,271 (GRCm39) missense possibly damaging 0.82
R8511:Cad UTSW 5 31,233,165 (GRCm39) missense probably benign 0.00
R8523:Cad UTSW 5 31,215,450 (GRCm39) missense probably damaging 0.98
R8690:Cad UTSW 5 31,232,500 (GRCm39) missense possibly damaging 0.58
R8697:Cad UTSW 5 31,231,945 (GRCm39) missense probably benign 0.06
R8698:Cad UTSW 5 31,234,819 (GRCm39) missense probably benign
R8699:Cad UTSW 5 31,233,605 (GRCm39) missense possibly damaging 0.80
R8803:Cad UTSW 5 31,226,908 (GRCm39) missense probably damaging 1.00
R9262:Cad UTSW 5 31,225,009 (GRCm39) missense probably null
R9272:Cad UTSW 5 31,218,576 (GRCm39) missense possibly damaging 0.91
R9287:Cad UTSW 5 31,230,000 (GRCm39) missense possibly damaging 0.67
R9314:Cad UTSW 5 31,234,988 (GRCm39) missense probably damaging 1.00
R9609:Cad UTSW 5 31,228,018 (GRCm39) critical splice donor site probably null
R9665:Cad UTSW 5 31,229,703 (GRCm39) missense probably benign 0.28
RF001:Cad UTSW 5 31,217,556 (GRCm39) critical splice donor site probably benign
RF012:Cad UTSW 5 31,217,556 (GRCm39) critical splice donor site probably benign
X0021:Cad UTSW 5 31,225,475 (GRCm39) missense probably null 1.00
X0022:Cad UTSW 5 31,229,661 (GRCm39) missense probably damaging 0.99
Z1177:Cad UTSW 5 31,232,472 (GRCm39) missense probably benign 0.25
Z1177:Cad UTSW 5 31,225,765 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCCCCAACTCAAGCTGTAGG -3'
(R):5'- CTGTCAAGGGTCAAGGGTCAAGTC -3'

Sequencing Primer
(F):5'- TCCTTAAGCACAGGGATTGAC -3'
(R):5'- CTACATAGGTGTCCTCCTGGAGAG -3'
Posted On 2013-05-23