Incidental Mutation 'R4951:Adcy10'
ID 381951
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 042548-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.233) question?
Stock # R4951 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 165391532 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1263 (L1263P)
Ref Sequence ENSEMBL: ENSMUSP00000107067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: L1263P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: L1263P

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: L1263P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: L1263P

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: L1263P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: L1263P

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Meta Mutation Damage Score 0.3914 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 G A 11: 7,088,336 (GRCm39) E452K possibly damaging Het
Adgrg1 G A 8: 95,731,874 (GRCm39) V179M probably damaging Het
Agap1 T A 1: 89,537,225 (GRCm39) V77E probably damaging Het
Ahnak A T 19: 8,995,199 (GRCm39) K5494N probably damaging Het
Arhgap19 A G 19: 41,762,545 (GRCm39) M437T probably benign Het
C2cd4c C A 10: 79,448,839 (GRCm39) A103S possibly damaging Het
Clip1 A T 5: 123,768,408 (GRCm39) D776E probably benign Het
Cntn3 C T 6: 102,145,986 (GRCm39) V952M possibly damaging Het
Col6a6 A G 9: 105,644,397 (GRCm39) probably null Het
Crtac1 C T 19: 42,402,570 (GRCm39) A13T probably benign Het
Ddx50 C T 10: 62,469,899 (GRCm39) A363T probably damaging Het
Dock9 A G 14: 121,890,547 (GRCm39) V241A probably benign Het
Dysf T C 6: 84,091,102 (GRCm39) probably null Het
Enpp3 A T 10: 24,674,175 (GRCm39) M375K probably damaging Het
Fam13c G A 10: 70,387,621 (GRCm39) probably null Het
Ftcd C T 10: 76,420,517 (GRCm39) A417V probably benign Het
Gak A G 5: 108,730,584 (GRCm39) S941P probably benign Het
Ganc A G 2: 120,286,528 (GRCm39) T786A probably benign Het
Gfi1 A C 5: 107,868,009 (GRCm39) S420A probably damaging Het
Ghsr A T 3: 27,426,510 (GRCm39) T189S possibly damaging Het
Glb1l C T 1: 75,185,019 (GRCm39) G122D probably damaging Het
Gm10065 C T 13: 21,663,421 (GRCm39) S64N unknown Het
Gm5087 C A 14: 13,158,749 (GRCm38) noncoding transcript Het
Gm973 G A 1: 59,580,633 (GRCm39) probably null Het
Gm9930 A T 10: 9,410,449 (GRCm39) noncoding transcript Het
H6pd A T 4: 150,066,044 (GRCm39) Y781N probably damaging Het
Ide G A 19: 37,262,631 (GRCm39) L695F unknown Het
Il17re T A 6: 113,445,868 (GRCm39) V393E probably damaging Het
Lipo3 A G 19: 33,759,621 (GRCm39) V205A probably benign Het
Lipo5 C T 19: 33,446,251 (GRCm39) E49K probably damaging Het
Lonp1 A T 17: 56,927,335 (GRCm39) M306K possibly damaging Het
Lrig1 A G 6: 94,640,959 (GRCm39) L82P probably damaging Het
Lrp2 A T 2: 69,366,332 (GRCm39) C256S probably damaging Het
Map1b A T 13: 99,568,935 (GRCm39) I1262K unknown Het
Mctp1 C T 13: 76,975,894 (GRCm39) P756S probably damaging Het
Mdn1 T A 4: 32,707,459 (GRCm39) W1583R probably damaging Het
Mis12 T A 11: 70,916,473 (GRCm39) Y169N probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Msh5 G A 17: 35,257,396 (GRCm39) Q333* probably null Het
Necap2 A T 4: 140,799,834 (GRCm39) probably null Het
Nfatc2 T C 2: 168,412,992 (GRCm39) D211G probably damaging Het
Nlrx1 A G 9: 44,164,726 (GRCm39) V906A possibly damaging Het
Or2ak7 G A 11: 58,575,589 (GRCm39) V297I probably damaging Het
Or4a2 T A 2: 89,248,116 (GRCm39) I214F probably benign Het
Or4l1 A T 14: 50,166,515 (GRCm39) L162* probably null Het
Or5b125-ps1 A T 19: 13,056,620 (GRCm39) noncoding transcript Het
Or8g24 A G 9: 38,989,555 (GRCm39) F162S probably benign Het
Pate5 A G 9: 35,750,732 (GRCm39) V30A probably damaging Het
Pkhd1l1 T A 15: 44,397,287 (GRCm39) N2057K possibly damaging Het
Ppip5k2 T C 1: 97,639,474 (GRCm39) K1078R possibly damaging Het
Prdm11 A G 2: 92,810,954 (GRCm39) I215T probably damaging Het
Ptpn13 C T 5: 103,735,912 (GRCm39) P2137L probably benign Het
Rif1 T A 2: 51,974,998 (GRCm39) probably null Het
Rnf17 T C 14: 56,759,848 (GRCm39) V1551A probably benign Het
Ror2 C T 13: 53,271,183 (GRCm39) V391I probably benign Het
Rps6ka2 A T 17: 7,560,188 (GRCm39) D542V probably damaging Het
Sema4g A G 19: 44,985,010 (GRCm39) probably null Het
Serpinb6d T G 13: 33,850,366 (GRCm39) S64R probably benign Het
Serpine1 C T 5: 137,098,205 (GRCm39) R156K probably benign Het
Setdb2 A G 14: 59,639,752 (GRCm39) I713T possibly damaging Het
Slamf7 A G 1: 171,466,693 (GRCm39) F171L probably benign Het
Slc15a5 A G 6: 138,050,064 (GRCm39) L117S probably damaging Het
Slc8a3 T A 12: 81,361,473 (GRCm39) T449S probably benign Het
Slc8a3 T A 12: 81,362,760 (GRCm39) T20S probably damaging Het
Smc2 G A 4: 52,462,926 (GRCm39) V639M possibly damaging Het
Sra1 A T 18: 36,809,494 (GRCm39) C223* probably null Het
Srgap1 A T 10: 121,621,457 (GRCm39) M1012K probably benign Het
Stk-ps2 A T 1: 46,068,602 (GRCm39) noncoding transcript Het
Taar6 A T 10: 23,861,106 (GRCm39) S147T probably benign Het
Taf15 G A 11: 83,375,637 (GRCm39) G34D possibly damaging Het
Tarbp1 T C 8: 127,174,184 (GRCm39) E874G possibly damaging Het
Tob2 T C 15: 81,735,924 (GRCm39) Y15C probably damaging Het
Trim12a A G 7: 103,953,565 (GRCm39) V182A possibly damaging Het
Trim67 A G 8: 125,521,406 (GRCm39) E256G probably benign Het
Trrap T A 5: 144,742,530 (GRCm39) S1382T possibly damaging Het
Ttc39d T A 17: 80,523,462 (GRCm39) S40R probably benign Het
Ttn A T 2: 76,779,406 (GRCm39) V1158E probably benign Het
Vmn1r19 C T 6: 57,381,927 (GRCm39) T160I probably benign Het
Vmn2r100 T C 17: 19,752,300 (GRCm39) I781T probably benign Het
Vmn2r85 T C 10: 130,261,113 (GRCm39) E408G probably damaging Het
Vwde T C 6: 13,187,138 (GRCm39) D783G probably damaging Het
Wdr27 A T 17: 15,096,395 (GRCm39) D796E probably damaging Het
Zfp365 C T 10: 67,725,821 (GRCm39) probably null Het
Zfp9 T G 6: 118,441,408 (GRCm39) H418P probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTCTGTACCCAAGCCCATGG -3'
(R):5'- AAGCAATCAGGCTGTGTTTG -3'

Sequencing Primer
(F):5'- GGCATTGCTCCGTGTTTAACAAAC -3'
(R):5'- GTACTACATGTGACTTTATGCGTTC -3'
Posted On 2016-04-27