Incidental Mutation 'R4951:Rif1'
ID381953
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Namereplication timing regulatory factor 1
Synonyms6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission 042548-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4951 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52072832-52122383 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 52084986 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
Predicted Effect probably null
Transcript: ENSMUST00000069794
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112693
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A G 9: 35,839,436 V30A probably damaging Het
Adcy1 G A 11: 7,138,336 E452K possibly damaging Het
Adcy10 T C 1: 165,563,963 L1263P probably damaging Het
Adgrg1 G A 8: 95,005,246 V179M probably damaging Het
Agap1 T A 1: 89,609,503 V77E probably damaging Het
Ahnak A T 19: 9,017,835 K5494N probably damaging Het
Arhgap19 A G 19: 41,774,106 M437T probably benign Het
C2cd4c C A 10: 79,613,005 A103S possibly damaging Het
Clip1 A T 5: 123,630,345 D776E probably benign Het
Cntn3 C T 6: 102,169,025 V952M possibly damaging Het
Col6a6 A G 9: 105,767,198 probably null Het
Crtac1 C T 19: 42,414,131 A13T probably benign Het
Ddx50 C T 10: 62,634,120 A363T probably damaging Het
Dock9 A G 14: 121,653,135 V241A probably benign Het
Dysf T C 6: 84,114,120 probably null Het
Enpp3 A T 10: 24,798,277 M375K probably damaging Het
Fam13c G A 10: 70,551,791 probably null Het
Ftcd C T 10: 76,584,683 A417V probably benign Het
Gak A G 5: 108,582,718 S941P probably benign Het
Ganc A G 2: 120,456,047 T786A probably benign Het
Gfi1 A C 5: 107,720,143 S420A probably damaging Het
Ghsr A T 3: 27,372,361 T189S possibly damaging Het
Glb1l C T 1: 75,208,375 G122D probably damaging Het
Gm10065 C T 13: 21,479,251 S64N unknown Het
Gm5087 C A 14: 13,158,749 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 G A 1: 59,541,474 probably null Het
Gm9930 A T 10: 9,534,705 noncoding transcript Het
H6pd A T 4: 149,981,587 Y781N probably damaging Het
Ide G A 19: 37,285,232 L695F unknown Het
Il17re T A 6: 113,468,907 V393E probably damaging Het
Lipo1 A G 19: 33,782,221 V205A probably benign Het
Lipo5 C T 19: 33,468,851 E49K probably damaging Het
Lonp1 A T 17: 56,620,335 M306K possibly damaging Het
Lrig1 A G 6: 94,663,978 L82P probably damaging Het
Lrp2 A T 2: 69,535,988 C256S probably damaging Het
Map1b A T 13: 99,432,427 I1262K unknown Het
Mctp1 C T 13: 76,827,775 P756S probably damaging Het
Mdn1 T A 4: 32,707,459 W1583R probably damaging Het
Mis12 T A 11: 71,025,647 Y169N probably benign Het
Msh5 G A 17: 35,038,420 Q333* probably null Het
Necap2 A T 4: 141,072,523 probably null Het
Nfatc2 T C 2: 168,571,072 D211G probably damaging Het
Nlrx1 A G 9: 44,253,429 V906A possibly damaging Het
Olfr1239 T A 2: 89,417,772 I214F probably benign Het
Olfr1456-ps1 A T 19: 13,079,256 noncoding transcript Het
Olfr320 G A 11: 58,684,763 V297I probably damaging Het
Olfr723 A T 14: 49,929,058 L162* probably null Het
Olfr938 A G 9: 39,078,259 F162S probably benign Het
Pkhd1l1 T A 15: 44,533,891 N2057K possibly damaging Het
Ppip5k2 T C 1: 97,711,749 K1078R possibly damaging Het
Prdm11 A G 2: 92,980,609 I215T probably damaging Het
Ptpn13 C T 5: 103,588,046 P2137L probably benign Het
Rnf17 T C 14: 56,522,391 V1551A probably benign Het
Ror2 C T 13: 53,117,147 V391I probably benign Het
Rps6ka2 A T 17: 7,292,789 D542V probably damaging Het
Sema4g A G 19: 44,996,571 probably null Het
Serpinb6d T G 13: 33,666,383 S64R probably benign Het
Serpine1 C T 5: 137,069,351 R156K probably benign Het
Setdb2 A G 14: 59,402,303 I713T possibly damaging Het
Slamf7 A G 1: 171,639,125 F171L probably benign Het
Slc15a5 A G 6: 138,073,066 L117S probably damaging Het
Slc8a3 T A 12: 81,314,699 T449S probably benign Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Smc2 G A 4: 52,462,926 V639M possibly damaging Het
Sra1 A T 18: 36,676,441 C223* probably null Het
Srgap1 A T 10: 121,785,552 M1012K probably benign Het
Stk-ps2 A T 1: 46,029,442 noncoding transcript Het
Taar6 A T 10: 23,985,208 S147T probably benign Het
Taf15 G A 11: 83,484,811 G34D possibly damaging Het
Tarbp1 T C 8: 126,447,445 E874G possibly damaging Het
Tob2 T C 15: 81,851,723 Y15C probably damaging Het
Trim12a A G 7: 104,304,358 V182A possibly damaging Het
Trim67 A G 8: 124,794,667 E256G probably benign Het
Trrap T A 5: 144,805,720 S1382T possibly damaging Het
Ttc39d T A 17: 80,216,033 S40R probably benign Het
Ttn A T 2: 76,949,062 V1158E probably benign Het
Vmn1r19 C T 6: 57,404,942 T160I probably benign Het
Vmn2r100 T C 17: 19,532,038 I781T probably benign Het
Vmn2r85 T C 10: 130,425,244 E408G probably damaging Het
Vwde T C 6: 13,187,139 D783G probably damaging Het
Wdr27 A T 17: 14,876,133 D796E probably damaging Het
Zfp365 C T 10: 67,889,991 probably null Het
Zfp9 T G 6: 118,464,447 H418P probably damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 intron probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
R7549:Rif1 UTSW 2 52078507 missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52076175 missense probably damaging 1.00
R7673:Rif1 UTSW 2 52088654 missense probably damaging 1.00
R7741:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R7777:Rif1 UTSW 2 52116356 missense probably benign 0.00
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGCCACTATGGTTCTTTGCC -3'
(R):5'- AGCTGAGGTCCAAGTCTCATCAG -3'

Sequencing Primer
(F):5'- CTAAATGGGAGTAGCATCCCTTCAG -3'
(R):5'- GAGGTCCAAGTCTCATCAGTAAATAC -3'
Posted On2016-04-27